Molecule Information
General Information of the Molecule (ID: Mol01713)
| Name |
hsa-miR-34b-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 34b
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
CAAUCACUAACUCCACUGCCAU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Bladder cancer [ICD-11: 2C94.0] | [1] | |||
| Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| Notch/PkC/Ca++ signaling pathway | Inhibition | hsa04330 | ||
| In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
| EJ cells | Bladder | Homo sapiens (Human) | CVCL_UI82 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | miR-34b-3p represses the multidrug-chemoresistance (Paclitaxel; Pirarubicin; Epirubicin hydrochloride; Adriamycin; Cisplatin) of bladder cancer cells by regulating the CCND2 and P2RY1 genes. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Bladder cancer [ICD-11: 2C94.0] | [1] | |||
| Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| Notch/PkC/Ca++ signaling pathway | Inhibition | hsa04330 | ||
| In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
| EJ cells | Bladder | Homo sapiens (Human) | CVCL_UI82 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | miR-34b-3p Represses the Multidrug-Chemoresistance of Bladder Cancer Cells by Regulating the CCND2 and P2RY1 Genes. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Bladder cancer [ICD-11: 2C94.0] | [1] | |||
| Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
| Resistant Drug | Epirubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| Notch/PkC/Ca++ signaling pathway | Inhibition | hsa04330 | ||
| In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
| EJ cells | Bladder | Homo sapiens (Human) | CVCL_UI82 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | miR-34b-3p Represses the Multidrug-Chemoresistance of Bladder Cancer Cells by Regulating the CCND2 and P2RY1 Genes. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Bladder cancer [ICD-11: 2C94.0] | [1] | |||
| Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| Notch/PkC/Ca++ signaling pathway | Inhibition | hsa04330 | ||
| In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
| EJ cells | Bladder | Homo sapiens (Human) | CVCL_UI82 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | miR-34b-3p Represses the Multidrug-Chemoresistance of Bladder Cancer Cells by Regulating the CCND2 and P2RY1 Genes. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Bladder cancer [ICD-11: 2C94.0] | [1] | |||
| Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
| Resistant Drug | Pirarubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| Notch/PkC/Ca++ signaling pathway | Inhibition | hsa04330 | ||
| In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
| EJ cells | Bladder | Homo sapiens (Human) | CVCL_UI82 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | miR-34b-3p Represses the Multidrug-Chemoresistance of Bladder Cancer Cells by Regulating the CCND2 and P2RY1 Genes. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
