General Information of the Molecule (ID: Mol01713)
Name
hsa-miR-34b-3p ,Homo sapiens
Synonyms
microRNA 34b
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CAAUCACUAACUCCACUGCCAU
    Click to Show/Hide
Ensembl ID
ENSG00000207811
HGNC ID
HGNC:31636
Mature Accession
MIMAT0004676
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0] [1]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
Notch/PkC/Ca++ signaling pathway Inhibition hsa04330
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
EJ cells Bladder Homo sapiens (Human) CVCL_UI82
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR-34b-3p represses the multidrug-chemoresistance (Paclitaxel; Pirarubicin; Epirubicin hydrochloride; Adriamycin; Cisplatin) of bladder cancer cells by regulating the CCND2 and P2RY1 genes.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0] [1]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
Notch/PkC/Ca++ signaling pathway Inhibition hsa04330
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
EJ cells Bladder Homo sapiens (Human) CVCL_UI82
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR-34b-3p Represses the Multidrug-Chemoresistance of Bladder Cancer Cells by Regulating the CCND2 and P2RY1 Genes.
Epirubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0] [1]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
Resistant Drug Epirubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
Notch/PkC/Ca++ signaling pathway Inhibition hsa04330
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
EJ cells Bladder Homo sapiens (Human) CVCL_UI82
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR-34b-3p Represses the Multidrug-Chemoresistance of Bladder Cancer Cells by Regulating the CCND2 and P2RY1 Genes.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0] [1]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
Notch/PkC/Ca++ signaling pathway Inhibition hsa04330
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
EJ cells Bladder Homo sapiens (Human) CVCL_UI82
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR-34b-3p Represses the Multidrug-Chemoresistance of Bladder Cancer Cells by Regulating the CCND2 and P2RY1 Genes.
Pirarubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0] [1]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
Resistant Drug Pirarubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
Notch/PkC/Ca++ signaling pathway Inhibition hsa04330
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
EJ cells Bladder Homo sapiens (Human) CVCL_UI82
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR-34b-3p Represses the Multidrug-Chemoresistance of Bladder Cancer Cells by Regulating the CCND2 and P2RY1 Genes.
References
Ref 1 MiR-34b-3p Represses the Multidrug-Chemoresistance of Bladder Cancer Cells by Regulating the CCND2 and P2RY1 Genes. Med Sci Monit. 2019 Feb 19;25:1323-1335. doi: 10.12659/MSM.913746.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.