Molecule Information

General Information of the Molecule (ID: Mol01711)

• Name: hsa-miR-193a-5p ,Homo sapiens
• Synonyms: microRNA 193a
• Molecule Type: Mature miRNA
• Sequence: UGGGUCUUUGCGGGCGAGAUGA
• Ensembl ID: ENSG00000207614
• HGNC ID: HGNC:31563
• Mature Accession: MIMAT0004614

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Docetaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [1]

• Sensitive Disease: Prostate cancer [ICD-11: 2C82.0]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: miR193a-5p/Bach2/HO1 signaling pathway; Inhibition; hsa05206
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: LNCaP cells; Prostate; Homo sapiens (Human); CVCL_0395
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: T24 cells; Bladder; Homo sapiens (Human); CVCL_0554
• In Vitro Model: RWPE-1 cells; Prostate; Homo sapiens (Human); CVCL_3791
• In Vitro Model: UM-UC-3 cells; Bladder; Homo sapiens (Human); CVCL_1783
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: TUNEL assays
• Mechanism Description: Silencing of miR193a-5p or blockade of the miR193a-5p-Bach2-HO-1 pathway enhances sensitization of PC3 cells to docetaxel-induced apoptosis. Docetaxel-induced miR193a-5p upregulation, which in turn inhibits Bach2 expression and thus relieves Bach2 repression of HO-1 expression, partly counteracted docetaxel-induced apoptosis.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [2]

• Sensitive Disease: Glioma [ICD-11: 2A00.1]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vitro Model: U257 cells; Brain; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Flow cytometry assay; MTT assay; Transwell assay
• Mechanism Description: Upregulation of CASC2 sensitized glioma to temozolomide cytotoxicity through autophagy inhibition by sponging miR193a-5p and regulating mTOR expression. mTOR or CASC2 overexpression or miR193a-5p inhibition remarkably reduced autophagy-related proteins expression.

References

• Ref 1: Silencing of miR-193a-5p increases the chemosensitivity of prostate cancer cells to docetaxel. J Exp Clin Cancer Res. 2017 Dec 8;36(1):178. doi: 10.1186/s13046-017-0649-3.
• Ref 2: Upregulation of CASC2 sensitized glioma to temozolomide cytotoxicity through autophagy inhibition by sponging miR-193a-5p and regulating mTOR expression. Biomed Pharmacother. 2018 Jan;97:844-850. doi: 10.1016/j.biopha.2017.10.146. Epub 2017 Nov 7.