Molecule Information
General Information of the Molecule (ID: Mol01711)
| Name |
hsa-miR-193a-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 193a
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UGGGUCUUUGCGGGCGAGAUGA
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Prostate cancer [ICD-11: 2C82.0] | [1] | |||
| Sensitive Disease | Prostate cancer [ICD-11: 2C82.0] | |||
| Sensitive Drug | Docetaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | miR193a-5p/Bach2/HO1 signaling pathway | Inhibition | hsa05206 | |
| In Vitro Model | DU-145 cells | Prostate | Homo sapiens (Human) | CVCL_0105 |
| LNCaP cells | Prostate | Homo sapiens (Human) | CVCL_0395 | |
| PC3 cells | Prostate | Homo sapiens (Human) | CVCL_0035 | |
| T24 cells | Bladder | Homo sapiens (Human) | CVCL_0554 | |
| RWPE-1 cells | Prostate | Homo sapiens (Human) | CVCL_3791 | |
| UM-UC-3 cells | Bladder | Homo sapiens (Human) | CVCL_1783 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
TUNEL assays | |||
| Mechanism Description | Silencing of miR193a-5p or blockade of the miR193a-5p-Bach2-HO-1 pathway enhances sensitization of PC3 cells to docetaxel-induced apoptosis. Docetaxel-induced miR193a-5p upregulation, which in turn inhibits Bach2 expression and thus relieves Bach2 repression of HO-1 expression, partly counteracted docetaxel-induced apoptosis. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioma [ICD-11: 2A00.1] | [2] | |||
| Sensitive Disease | Glioma [ICD-11: 2A00.1] | |||
| Sensitive Drug | Temozolomide | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 |
| U257 cells | Brain | Homo sapiens (Human) | N.A. | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay; MTT assay; Transwell assay | |||
| Mechanism Description | Upregulation of CASC2 sensitized glioma to temozolomide cytotoxicity through autophagy inhibition by sponging miR193a-5p and regulating mTOR expression. mTOR or CASC2 overexpression or miR193a-5p inhibition remarkably reduced autophagy-related proteins expression. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
