Molecule Information
General Information of the Molecule (ID: Mol01710)
Name |
hsa-miR-188-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 188
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
CUCCCACAUGCAGGGUUUGCA
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Pancreatic cancer | [1] | |||
Resistant Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
Resistant Drug | Gemcitabine | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | BxPC-3 cells | Pancreas | Homo sapiens (Human) | CVCL_0186 |
MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 | |
PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 | |
Capan-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0237 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay; Soft agar assay | |||
Mechanism Description | Long non-coding RNA LINC00346 promotes pancreatic cancer growth and gemcitabine resistance by sponging miR-188-3p to derepress BRD4 expression. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.