General Information of the Molecule (ID: Mol01710)
Name
hsa-miR-188-3p ,Homo sapiens
Synonyms
microRNA 188
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CUCCCACAUGCAGGGUUUGCA
    Click to Show/Hide
Ensembl ID
ENSG00000207768
HGNC ID
HGNC:31559
Mature Accession
MIMAT0004613
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [1]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
Resistant Drug Gemcitabine
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
Capan-1 cells Pancreas Homo sapiens (Human) CVCL_0237
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay; Soft agar assay
Mechanism Description Long non-coding RNA LINC00346 promotes pancreatic cancer growth and gemcitabine resistance by sponging miR-188-3p to derepress BRD4 expression.
References
Ref 1 Long non-coding RNA LINC00346 promotes pancreatic cancer growth and gemcitabine resistance by sponging miR-188-3p to derepress BRD4 expression. J Exp Clin Cancer Res. 2019 Feb 6;38(1):60. doi: 10.1186/s13046-019-1055-9.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.