Molecule Information

General Information of the Molecule (ID: Mol01706)

• Name: hsa-miR-106a-3p ,Homo sapiens
• Synonyms: microRNA 106a
• Molecule Type: Mature miRNA
• Sequence: CUGCAAUGUAAGCACUUCUUAC
• Ensembl ID: ENSG00000284157
• HGNC ID: HGNC:31494
• Mature Accession: MIMAT0004517

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell colony; Activation; hsa05200
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-106a promotes breast cancer cell proliferation and invasion through upregulation of Bcl-2, ABCG2, and P53, and downregulation of Bax and RUNX3.

References

• Ref 1: miRNA-106a Promotes Breast Cancer Cell Proliferation, Clonogenicity, Migration, and Invasion Through Inhibiting Apoptosis and Chemosensitivity. DNA Cell Biol. 2019 Feb;38(2):198-207. doi: 10.1089/dna.2018.4282. Epub 2018 Dec 20.