Molecule Information

General Information of the Molecule (ID: Mol01706)

• Name: hsa-miR-106a-3p ,Homo sapiens
• Synonyms: microRNA 106a
• Molecule Type: Mature miRNA
• Sequence: CUGCAAUGUAAGCACUUCUUAC
• Ensembl ID: ENSG00000284157
• HGNC ID: HGNC:31494
• Mature Accession: MIMAT0004517

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell colony; Activation; hsa05200
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-106a promotes breast cancer cell proliferation and invasion through upregulation of Bcl-2, ABCG2, and P53, and downregulation of Bax and RUNX3.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BT-20 cells; Mammary gland; Homo sapiens (Human); CVCL_0178
• In Vitro Model: BT-474 cells; Breast; Homo sapiens (Human); CVCL_0179
• In Vitro Model: BT-549 cells; Breast; Homo sapiens (Human); CVCL_1092
• In Vitro Model: CAMA-1 cells; Breast; Homo sapiens (Human); CVCL_1115
• In Vitro Model: HCC1143 cells; Breast; Homo sapiens (Human); CVCL_1245
• In Vitro Model: HCC1806 cells; Breast; Homo sapiens (Human); CVCL_1258
• In Vitro Model: HCC1937 cells; Breast; Homo sapiens (Human); CVCL_0290
• In Vitro Model: HCC1954 cells; Breast; Homo sapiens (Human); CVCL_1259
• In Vitro Model: HCC38 cells; Breast; Homo sapiens (Human); CVCL_1267
• In Vitro Model: HCC70 cells; Breast; Homo sapiens (Human); CVCL_1270
• In Vitro Model: Hs578T cells; Breast; Homo sapiens (Human); CVCL_0332
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-361 cells; Breast; Homo sapiens (Human); CVCL_0620
• In Vitro Model: MDA-MB-436 cells; Breast; Homo sapiens (Human); CVCL_0623
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vitro Model: SK-BR-3 cells; Pleural effusion; Homo sapiens (Human); CVCL_0033
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: EVSA-T cells; Ascites; Homo sapiens (Human); CVCL_1207
• In Vitro Model: Sk-BR-7 cells; Breast; Homo sapiens (Human); CVCL_5218
• In Vitro Model: SUM159PT cells; Breast; Homo sapiens (Human); CVCL_5423/CVCL_5590
• In Vitro Model: SUM44PE cells; Breast; Homo sapiens (Human); CVCL_3424
• In Vitro Model: SUM52PE cells; Breast; Homo sapiens (Human); CVCL_3425
• Experiment for Molecule Alteration: Microarray analyses
• Mechanism Description: The taxanes, Paclitaxel and Docetaxel, were the only drugs having miRNAs in common: hsa-miR-187-5p and hsa-miR-106a-3p indicative of drug resistance while Paclitaxel sensitivity alone associated with hsa-miR-556-5p

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BT-20 cells; Mammary gland; Homo sapiens (Human); CVCL_0178
• In Vitro Model: BT-474 cells; Breast; Homo sapiens (Human); CVCL_0179
• In Vitro Model: BT-549 cells; Breast; Homo sapiens (Human); CVCL_1092
• In Vitro Model: CAMA-1 cells; Breast; Homo sapiens (Human); CVCL_1115
• In Vitro Model: HCC1143 cells; Breast; Homo sapiens (Human); CVCL_1245
• In Vitro Model: HCC1806 cells; Breast; Homo sapiens (Human); CVCL_1258
• In Vitro Model: HCC1937 cells; Breast; Homo sapiens (Human); CVCL_0290
• In Vitro Model: HCC1954 cells; Breast; Homo sapiens (Human); CVCL_1259
• In Vitro Model: HCC38 cells; Breast; Homo sapiens (Human); CVCL_1267
• In Vitro Model: HCC70 cells; Breast; Homo sapiens (Human); CVCL_1270
• In Vitro Model: Hs578T cells; Breast; Homo sapiens (Human); CVCL_0332
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-361 cells; Breast; Homo sapiens (Human); CVCL_0620
• In Vitro Model: MDA-MB-436 cells; Breast; Homo sapiens (Human); CVCL_0623
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vitro Model: SK-BR-3 cells; Pleural effusion; Homo sapiens (Human); CVCL_0033
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: EVSA-T cells; Ascites; Homo sapiens (Human); CVCL_1207
• In Vitro Model: Sk-BR-7 cells; Breast; Homo sapiens (Human); CVCL_5218
• In Vitro Model: SUM159PT cells; Breast; Homo sapiens (Human); CVCL_5423/CVCL_5590
• In Vitro Model: SUM44PE cells; Breast; Homo sapiens (Human); CVCL_3424
• In Vitro Model: SUM52PE cells; Breast; Homo sapiens (Human); CVCL_3425
• Experiment for Molecule Alteration: Microarray analyses
• Mechanism Description: This gene is up-regulated in paclitaxel-resistance cells

References

• Ref 1: miRNA-106a Promotes Breast Cancer Cell Proliferation, Clonogenicity, Migration, and Invasion Through Inhibiting Apoptosis and Chemosensitivity. DNA Cell Biol. 2019 Feb;38(2):198-207. doi: 10.1089/dna.2018.4282. Epub 2018 Dec 20.
• Ref 2: Alterations in p53 predict response to preoperative high dose chemotherapy in patients with gastric cancerMol Pathol. 2003 Oct;56(5):286-92. doi: 10.1136/mp.56.5.286.