Molecule Information
General Information of the Molecule (ID: Mol01704)
| Name |
hsa-miR-21-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 21
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
CAACACCAGUCGAUGGGCUGU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [1] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 |
| OVCAR5 cells | Ovary | Homo sapiens (Human) | CVCL_1628 | |
| IGROV1 cells | Ovary | Homo sapiens (Human) | CVCL_1304 | |
| OVCAR8 cells | Ovary | Homo sapiens (Human) | CVCL_1629 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Several miRNAs that are increased in cisplatin-resistant cells. We show that most of these do not directly contribute to cisplatin resistance. Interestingly, miR-21-3p, the passenger strand of the known oncomiR, directed increased resistance to cisplatin in a range of ovarian cell lines. This effect was specific to the star strand, as miR-21-5p had the opposite effect and actually increased sensitivity of A2780 cells to cisplatin. We identify NAV3 as a potential target of miR-21-3p and show that knockdown of NAV3 increases resistance. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
