General Information of the Molecule (ID: Mol01704)
Name
hsa-miR-21-3p ,Homo sapiens
Synonyms
microRNA 21
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CAACACCAGUCGAUGGGCUGU
    Click to Show/Hide
Ensembl ID
ENSG00000284190
HGNC ID
HGNC:31586
Mature Accession
MIMAT0004494
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model A2780 cells Ovary Homo sapiens (Human) CVCL_0134
OVCAR5 cells Ovary Homo sapiens (Human) CVCL_1628
IGROV1 cells Ovary Homo sapiens (Human) CVCL_1304
OVCAR8 cells Ovary Homo sapiens (Human) CVCL_1629
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Several miRNAs that are increased in cisplatin-resistant cells. We show that most of these do not directly contribute to cisplatin resistance. Interestingly, miR-21-3p, the passenger strand of the known oncomiR, directed increased resistance to cisplatin in a range of ovarian cell lines. This effect was specific to the star strand, as miR-21-5p had the opposite effect and actually increased sensitivity of A2780 cells to cisplatin. We identify NAV3 as a potential target of miR-21-3p and show that knockdown of NAV3 increases resistance.
References
Ref 1 The passenger strand, miR-21-3p, plays a role in mediating cisplatin resistance in ovarian cancer cells. Gynecol Oncol. 2015 Apr;137(1):143-51. doi: 10.1016/j.ygyno.2014.12.042. Epub 2015 Jan 8.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.