Molecule Information

General Information of the Molecule (ID: Mol01704)

• Name: hsa-miR-21-3p ,Homo sapiens
• Synonyms: microRNA 21
• Molecule Type: Mature miRNA
• Sequence: CAACACCAGUCGAUGGGCUGU
• Ensembl ID: ENSG00000284190
• HGNC ID: HGNC:31586
• Mature Accession: MIMAT0004494

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: OVCAR5 cells; Ovary; Homo sapiens (Human); CVCL_1628
• In Vitro Model: IGROV1 cells; Ovary; Homo sapiens (Human); CVCL_1304
• In Vitro Model: OVCAR8 cells; Ovary; Homo sapiens (Human); CVCL_1629
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Several miRNAs that are increased in cisplatin-resistant cells. We show that most of these do not directly contribute to cisplatin resistance. Interestingly, miR-21-3p, the passenger strand of the known oncomiR, directed increased resistance to cisplatin in a range of ovarian cell lines. This effect was specific to the star strand, as miR-21-5p had the opposite effect and actually increased sensitivity of A2780 cells to cisplatin. We identify NAV3 as a potential target of miR-21-3p and show that knockdown of NAV3 increases resistance.

References

• Ref 1: The passenger strand, miR-21-3p, plays a role in mediating cisplatin resistance in ovarian cancer cells. Gynecol Oncol. 2015 Apr;137(1):143-51. doi: 10.1016/j.ygyno.2014.12.042. Epub 2015 Jan 8.