Molecule Information
General Information of the Molecule (ID: Mol01698)
| Name |
hsa-miR-769-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 769
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UGAGACCUCUGGGUUCUGAGCU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [1] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Resistant Drug | Gefitinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell invasion | Activation | hsa05200 | ||
| Cell viability | Activation | hsa05200 | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| Sk-MES-1 cells | Lung | Homo sapiens (Human) | CVCL_0630 | |
| In Vivo Model | Tumor xenograft in vivo model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | Long Noncoding RNA LINC00460 promotes the gefitinib resistance of nonsmall cell lung cancer through EGFR by sponging miR-769-5p. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
