Molecule Information

General Information of the Molecule (ID: Mol01698)

• Name: hsa-miR-769-5p ,Homo sapiens
• Synonyms: microRNA 769
• Molecule Type: Mature miRNA
• Sequence: UGAGACCUCUGGGUUCUGAGCU
• Ensembl ID: ENSG00000211580
• HGNC ID: HGNC:33138
• Mature Accession: MIMAT0003886

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gefitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Gefitinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: Sk-MES-1 cells; Lung; Homo sapiens (Human); CVCL_0630
• In Vivo Model: Tumor xenograft in vivo model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: Long Noncoding RNA LINC00460 promotes the gefitinib resistance of nonsmall cell lung cancer through EGFR by sponging miR-769-5p.

References

• Ref 1: Long Noncoding RNA LINC00460 Promotes the Gefitinib Resistance of Nonsmall Cell Lung Cancer Through Epidermal Growth Factor Receptor by Sponging miR-769-5p. DNA Cell Biol. 2019 Feb;38(2):176-183. doi: 10.1089/dna.2018.4462. Epub 2019 Jan 2.