Molecule Information

General Information of the Molecule (ID: Mol01696)

Name	hsa-miR-425-5p ,Homo sapiens
Synonyms	microRNA 425 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	AAUGACACGAUCACUCCCGUUGA Click to Show/Hide
Ensembl ID	ENSG00000199032
HGNC ID	HGNC:31882
Mature Accession	MIMAT0003393
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

5 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Laryngeal carcinoma [ICD-11: 2C23.0]				[1]
Resistant Disease	Laryngeal carcinoma [ICD-11: 2C23.0]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Hedgehog signaling pathway		Regulation	N.A.
In Vitro Model	HEp-2 cells	Skin	Homo sapiens (Human)	CVCL_1906
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	CCK8 assay; Colony formation assay; Flow cytometry assay
Mechanism Description	Long noncoding RNA LINC-PINT regulates laryngeal carcinoma cell stemness and chemoresistance through miR-425-5p/PTCH1/SHH axis.

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0]				[2]
Resistant Disease	Gastric cancer [ICD-11: 2B72.0]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	MAPK signalling pathway		Regulation	N.A.
In Vitro Model	SGC7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
	SGC7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
Experiment for Molecule Alteration	MiRNA microarray analyses, qRT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	In this study, mRNA and miRNA expression profiling of the drug resistant sublines, SGC7901/VCR and SGC7901/ADR, and their parental gastric cancer cell line SGC7901 were performed. A significant number of genes and a limited subset of miRNAs were commonly dysregulated, which were further validated using qRT-PCR. GO and KEGG pathway analyses of the commonly dysregulated genes indicated that the MAPK signalling pathway may be involved in multidrug resistance, which was further validated using immunoblotting and MTT assay.

Fluorouracil

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1]				[3]
Sensitive Disease	Colorectal cancer [ICD-11: 2B91.1]			Disease Info
Sensitive Drug	Fluorouracil			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
In Vitro Model	HCT116 cells	Colon	Homo sapiens (Human)	CVCL_0291
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	CellTiter-Glo assay
Mechanism Description	miR-425-5p is up-regulated in HCT116-R cells with acquired resistance to 5-fluouracil and OX compared with the parental HCT116 cells. Inhibition of miR-425-5p increases sensitivity to anti-cancer drugs by regulating apoptosis-related protein PDCD10 both in vitro and in vivo.

Oxaliplatin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1]				[3]
Sensitive Disease	Colorectal cancer [ICD-11: 2B91.1]			Disease Info
Sensitive Drug	Oxaliplatin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
In Vitro Model	HCT116 cells	Colon	Homo sapiens (Human)	CVCL_0291
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	CellTiter-Glo assay
Mechanism Description	miR-425-5p is up-regulated in HCT116-R cells with acquired resistance to 5-fluouracil and OX compared with the parental HCT116 cells. Inhibition of miR-425-5p increases sensitivity to anti-cancer drugs by regulating apoptosis-related protein PDCD10 both in vitro and in vivo.

Vincristine

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0]				[2]
Resistant Disease	Gastric cancer [ICD-11: 2B72.0]			Disease Info
Resistant Drug	Vincristine			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	MAPK signalling pathway		Regulation	N.A.
In Vitro Model	SGC7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
	SGC7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
Experiment for Molecule Alteration	MiRNA microarray analyses, qRT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	In this study, mRNA and miRNA expression profiling of the drug resistant sublines, SGC7901/VCR and SGC7901/ADR, and their parental gastric cancer cell line SGC7901 were performed. A significant number of genes and a limited subset of miRNAs were commonly dysregulated, which were further validated using qRT-PCR. GO and KEGG pathway analyses of the commonly dysregulated genes indicated that the MAPK signalling pathway may be involved in multidrug resistance, which was further validated using immunoblotting and MTT assay.

Clinical Trial Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

PLX4720

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)		Click to Show/Hide
Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1]			[4]
Resistant Disease	Papillary thyroid carcinoma [ICD-11: 2D10.1]		Disease Info
Resistant Drug	PLX4720		Drug Info
Molecule Alteration	Expression	Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Experiment for Molecule Alteration	Immunoblot analysis; qRT-PCR
Experiment for Drug Resistance	Flow cytometry assay
Mechanism Description	This gene is up-regulated in PLX4720-resistance cells

References

Ref 1	Long noncoding RNA LINC-PINT regulates laryngeal carcinoma cell stemness and chemoresistance through miR-425-5p/PTCH1/SHH axis. J Cell Physiol. 2019 Dec;234(12):23111-23122. doi: 10.1002/jcp.28874. Epub 2019 May 26.
Ref 2	Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
Ref 3	MicroRNA-425-5p regulates chemoresistance in colorectal cancer cells via regulation of Programmed Cell Death 10. J Cell Mol Med. 2016 Feb;20(2):360-9. doi: 10.1111/jcmm.12742. Epub 2015 Dec 9.
Ref 4	Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.