Molecule Information
General Information of the Molecule (ID: Mol01696)
| Name |
hsa-miR-425-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 425
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
AAUGACACGAUCACUCCCGUUGA
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Laryngeal carcinoma [ICD-11: 2C23.0] | [1] | |||
| Resistant Disease | Laryngeal carcinoma [ICD-11: 2C23.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Hedgehog signaling pathway | Regulation | N.A. | ||
| In Vitro Model | HEp-2 cells | Skin | Homo sapiens (Human) | CVCL_1906 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Colony formation assay; Flow cytometry assay | |||
| Mechanism Description | Long noncoding RNA LINC-PINT regulates laryngeal carcinoma cell stemness and chemoresistance through miR-425-5p/PTCH1/SHH axis. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [2] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CellTiter-Glo assay | |||
| Mechanism Description | miR-425-5p is up-regulated in HCT116-R cells with acquired resistance to 5-fluouracil and OX compared with the parental HCT116 cells. Inhibition of miR-425-5p increases sensitivity to anti-cancer drugs by regulating apoptosis-related protein PDCD10 both in vitro and in vivo. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [2] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CellTiter-Glo assay | |||
| Mechanism Description | miR-425-5p is up-regulated in HCT116-R cells with acquired resistance to 5-fluouracil and OX compared with the parental HCT116 cells. Inhibition of miR-425-5p increases sensitivity to anti-cancer drugs by regulating apoptosis-related protein PDCD10 both in vitro and in vivo. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
