Molecule Information

General Information of the Molecule (ID: Mol01696)

• Name: hsa-miR-425-5p ,Homo sapiens
• Synonyms: microRNA 425
• Molecule Type: Mature miRNA
• Sequence: AAUGACACGAUCACUCCCGUUGA
• Ensembl ID: ENSG00000199032
• HGNC ID: HGNC:31882
• Mature Accession: MIMAT0003393

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Laryngeal carcinoma [1]

• Resistant Disease: Laryngeal carcinoma [ICD-11: 2C23.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Hedgehog signaling pathway; Regulation; hsa04340
• In Vitro Model: HEp-2 cells; Skin; Homo sapiens (Human); CVCL_1906
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay; Flow cytometry assay
• Mechanism Description: Long noncoding RNA LINC-PINT regulates laryngeal carcinoma cell stemness and chemoresistance through miR-425-5p/PTCH1/SHH axis.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [2]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CellTiter-Glo assay
• Mechanism Description: miR-425-5p is up-regulated in HCT116-R cells with acquired resistance to 5-fluouracil and OX compared with the parental HCT116 cells. Inhibition of miR-425-5p increases sensitivity to anti-cancer drugs by regulating apoptosis-related protein PDCD10 both in vitro and in vivo.

Oxaliplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [2]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CellTiter-Glo assay
• Mechanism Description: miR-425-5p is up-regulated in HCT116-R cells with acquired resistance to 5-fluouracil and OX compared with the parental HCT116 cells. Inhibition of miR-425-5p increases sensitivity to anti-cancer drugs by regulating apoptosis-related protein PDCD10 both in vitro and in vivo.

References

• Ref 1: Long noncoding RNA LINC-PINT regulates laryngeal carcinoma cell stemness and chemoresistance through miR-425-5p/PTCH1/SHH axis. J Cell Physiol. 2019 Dec;234(12):23111-23122. doi: 10.1002/jcp.28874. Epub 2019 May 26.
• Ref 2: MicroRNA-425-5p regulates chemoresistance in colorectal cancer cells via regulation of Programmed Cell Death 10. J Cell Mol Med. 2016 Feb;20(2):360-9. doi: 10.1111/jcmm.12742. Epub 2015 Dec 9.