Molecule Information
General Information of the Molecule (ID: Mol01694)
Name |
hsa-miR-421
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 421
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AUCAACAGACAUUAAUUGGGCGC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [1] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell invasion | Activation | hsa05200 | ||
Cell migration | Activation | hsa04670 | ||
N-Myc/ miR421 /ATM signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 | |
AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 | |
GES-1 cells | Gastric | Homo sapiens (Human) | CVCL_EQ22 | |
HGC27 cells | Gastric | Homo sapiens (Human) | CVCL_1279 | |
NCI-N87 cells | Gastric | Homo sapiens (Human) | CVCL_1603 | |
MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 | |
MkN28 cells | Gastric | Homo sapiens (Human) | CVCL_1416 | |
SNU-16 cells | Gastric | Homo sapiens (Human) | CVCL_0076 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | Overexpression of miR-421 promoted metastasis, inhibited apoptosis, and induced cisplatin resistance in gastric cancer by targeting E-cadherin and caspase-3. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.