Molecule Information

General Information of the Molecule (ID: Mol01694)

• Name: hsa-miR-421 ,Homo sapiens
• Synonyms: microRNA 421
• Molecule Type: Mature miRNA
• Sequence: AUCAACAGACAUUAAUUGGGCGC
• Ensembl ID: ENSG00000202566
• HGNC ID: HGNC:32793
• Mature Accession: MIMAT0003339

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: N-Myc/ miR421 /ATM signaling pathway; Regulation; hsa05206
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: GES-1 cells; Gastric; Homo sapiens (Human); CVCL_EQ22
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• In Vitro Model: MkN28 cells; Gastric; Homo sapiens (Human); CVCL_1416
• In Vitro Model: SNU-16 cells; Gastric; Homo sapiens (Human); CVCL_0076
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Overexpression of miR-421 promoted metastasis, inhibited apoptosis, and induced cisplatin resistance in gastric cancer by targeting E-cadherin and caspase-3.

References

• Ref 1: MicroRNA-421 regulated by HIF-1Alpha promotes metastasis, inhibits apoptosis, and induces cisplatin resistance by targeting E-cadherin and caspase-3 in gastric cancer. Oncotarget. 2016 Apr 26;7(17):24466-82. doi: 10.18632/oncotarget.8228.