General Information of the Molecule (ID: Mol01694)
Name
hsa-miR-421 ,Homo sapiens
Synonyms
microRNA 421
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AUCAACAGACAUUAAUUGGGCGC
    Click to Show/Hide
Ensembl ID
ENSG00000202566
HGNC ID
HGNC:32793
Mature Accession
MIMAT0003339
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
N-Myc/ miR421 /ATM signaling pathway Regulation N.A.
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
HEK293T cells Kidney Homo sapiens (Human) CVCL_0063
AGS cells Gastric Homo sapiens (Human) CVCL_0139
GES-1 cells Gastric Homo sapiens (Human) CVCL_EQ22
HGC27 cells Gastric Homo sapiens (Human) CVCL_1279
NCI-N87 cells Gastric Homo sapiens (Human) CVCL_1603
MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
MkN28 cells Gastric Homo sapiens (Human) CVCL_1416
SNU-16 cells Gastric Homo sapiens (Human) CVCL_0076
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description Overexpression of miR-421 promoted metastasis, inhibited apoptosis, and induced cisplatin resistance in gastric cancer by targeting E-cadherin and caspase-3.
References
Ref 1 MicroRNA-421 regulated by HIF-1Alpha promotes metastasis, inhibits apoptosis, and induces cisplatin resistance by targeting E-cadherin and caspase-3 in gastric cancer. Oncotarget. 2016 Apr 26;7(17):24466-82. doi: 10.18632/oncotarget.8228.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.