Molecule Information
General Information of the Molecule (ID: Mol01694)
| Name |
hsa-miR-421
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 421
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
AUCAACAGACAUUAAUUGGGCGC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell invasion | Activation | hsa05200 | ||
| Cell migration | Activation | hsa04670 | ||
| N-Myc/ miR421 /ATM signaling pathway | Regulation | N.A. | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 | |
| AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 | |
| GES-1 cells | Gastric | Homo sapiens (Human) | CVCL_EQ22 | |
| HGC27 cells | Gastric | Homo sapiens (Human) | CVCL_1279 | |
| NCI-N87 cells | Gastric | Homo sapiens (Human) | CVCL_1603 | |
| MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 | |
| MkN28 cells | Gastric | Homo sapiens (Human) | CVCL_1416 | |
| SNU-16 cells | Gastric | Homo sapiens (Human) | CVCL_0076 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | Overexpression of miR-421 promoted metastasis, inhibited apoptosis, and induced cisplatin resistance in gastric cancer by targeting E-cadherin and caspase-3. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
