Molecule Information
General Information of the Molecule (ID: Mol01692)
| Name |
hsa-miR-654-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 654
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UGGUGGGCCGCAGAACAUGUGC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Oral squamous cell carcinoma [ICD-11: 2B6E.0] | [1] | |||
| Resistant Disease | Oral squamous cell carcinoma [ICD-11: 2B6E.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | MAPK/RAS signaling pathway | Regulation | N.A. | |
| In Vitro Model | Tca8113 cells | Tongue | Homo sapiens (Human) | CVCL_6851 |
| CAL-27 cells | Tongue | Homo sapiens (Human) | CVCL_1107 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR654-5p targets GRAP to promote proliferation, metastasis, and chemoresistance of oral squamous cell carcinoma through Ras/MAPk signaling. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Oral squamous cell carcinoma [ICD-11: 2B6E.0] | [1] | |||
| Resistant Disease | Oral squamous cell carcinoma [ICD-11: 2B6E.0] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | MAPK/RAS signaling pathway | Regulation | N.A. | |
| In Vitro Model | Tca8113 cells | Tongue | Homo sapiens (Human) | CVCL_6851 |
| CAL-27 cells | Tongue | Homo sapiens (Human) | CVCL_1107 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR654-5p targets GRAP to promote proliferation, metastasis, and chemoresistance of oral squamous cell carcinoma through Ras/MAPk signaling. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [2] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| MYC/WNT/AKT signaling pathway | Regulation | N.A. | ||
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
| In Vivo Model | NMRI-nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Time course proliferation assay; Flow cytometry assay | |||
| Mechanism Description | CDCP1 and PLAGL2 oncogenes were found to be the most relevant direct miR-654-5p targets and both genes convey in a molecular signature associated with key cancer pathways relevant to ovarian tumorigenesis, such as MYC, WNT and AkT pathways. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
