Molecule Information

General Information of the Molecule (ID: Mol01692)

Name	hsa-miR-654-5p ,Homo sapiens
Synonyms	microRNA 654 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	UGGUGGGCCGCAGAACAUGUGC Click to Show/Hide
Ensembl ID	ENSG00000207934
HGNC ID	HGNC:32910
Mature Accession	MIMAT0003330
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

3 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Oral squamous cell carcinoma				[1]
Resistant Disease	Oral squamous cell carcinoma [ICD-11: 2B6E.0]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	MAPK/RAS signaling pathway		Regulation	hsa04010
In Vitro Model	Tca8113 cells	Tongue	Homo sapiens (Human)	CVCL_6851
	CAL-27 cells	Tongue	Homo sapiens (Human)	CVCL_1107
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	miR654-5p targets GRAP to promote proliferation, metastasis, and chemoresistance of oral squamous cell carcinoma through Ras/MAPk signaling.

Fluorouracil

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Oral squamous cell carcinoma				[1]
Resistant Disease	Oral squamous cell carcinoma [ICD-11: 2B6E.0]			Disease Info
Resistant Drug	Fluorouracil			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	MAPK/RAS signaling pathway		Regulation	hsa04010
In Vitro Model	Tca8113 cells	Tongue	Homo sapiens (Human)	CVCL_6851
	CAL-27 cells	Tongue	Homo sapiens (Human)	CVCL_1107
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	miR654-5p targets GRAP to promote proliferation, metastasis, and chemoresistance of oral squamous cell carcinoma through Ras/MAPk signaling.

Paclitaxel

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Ovarian cancer				[2]
Resistant Disease	Ovarian cancer [ICD-11: 2C73.0]			Disease Info
Resistant Drug	Paclitaxel			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell proliferation		Activation	hsa05200
	MYC/WNT/AKT signaling pathway		Regulation	hsa04217
In Vitro Model	SkOV3 cells	Ovary	Homo sapiens (Human)	CVCL_0532
	A2780 cells	Ovary	Homo sapiens (Human)	CVCL_0134
In Vivo Model	NMRI-nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	Time course proliferation assay; Flow cytometry assay
Mechanism Description	CDCP1 and PLAGL2 oncogenes were found to be the most relevant direct miR-654-5p targets and both genes convey in a molecular signature associated with key cancer pathways relevant to ovarian tumorigenesis, such as MYC, WNT and AkT pathways.

References

Ref 1	miR-654-5p Targets GRAP to Promote Proliferation, Metastasis, and Chemoresistance of Oral Squamous Cell Carcinoma Through Ras/MAPK Signaling. DNA Cell Biol. 2018 Apr;37(4):381-388. doi: 10.1089/dna.2017.4095. Epub 2018 Jan 24.
Ref 2	MicroRNA-654-5p suppresses ovarian cancer development impacting on MYC, WNT and AKT pathways. Oncogene. 2019 Aug;38(32):6035-6050. doi: 10.1038/s41388-019-0860-0. Epub 2019 Jul 5.