General Information of the Molecule (ID: Mol01692)
Name
hsa-miR-654-5p ,Homo sapiens
Synonyms
microRNA 654
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGGUGGGCCGCAGAACAUGUGC
    Click to Show/Hide
Ensembl ID
ENSG00000207934
HGNC ID
HGNC:32910
Mature Accession
MIMAT0003330
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Oral squamous cell carcinoma [ICD-11: 2B6E.0] [1]
Resistant Disease Oral squamous cell carcinoma [ICD-11: 2B6E.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation MAPK/RAS signaling pathway Regulation N.A.
In Vitro Model Tca8113 cells Tongue Homo sapiens (Human) CVCL_6851
CAL-27 cells Tongue Homo sapiens (Human) CVCL_1107
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR654-5p targets GRAP to promote proliferation, metastasis, and chemoresistance of oral squamous cell carcinoma through Ras/MAPk signaling.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Oral squamous cell carcinoma [ICD-11: 2B6E.0] [1]
Resistant Disease Oral squamous cell carcinoma [ICD-11: 2B6E.0]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation MAPK/RAS signaling pathway Regulation N.A.
In Vitro Model Tca8113 cells Tongue Homo sapiens (Human) CVCL_6851
CAL-27 cells Tongue Homo sapiens (Human) CVCL_1107
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR654-5p targets GRAP to promote proliferation, metastasis, and chemoresistance of oral squamous cell carcinoma through Ras/MAPk signaling.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
MYC/WNT/AKT signaling pathway Regulation N.A.
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
In Vivo Model NMRI-nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Time course proliferation assay; Flow cytometry assay
Mechanism Description CDCP1 and PLAGL2 oncogenes were found to be the most relevant direct miR-654-5p targets and both genes convey in a molecular signature associated with key cancer pathways relevant to ovarian tumorigenesis, such as MYC, WNT and AkT pathways.
References
Ref 1 miR-654-5p Targets GRAP to Promote Proliferation, Metastasis, and Chemoresistance of Oral Squamous Cell Carcinoma Through Ras/MAPK Signaling. DNA Cell Biol. 2018 Apr;37(4):381-388. doi: 10.1089/dna.2017.4095. Epub 2018 Jan 24.
Ref 2 MicroRNA-654-5p suppresses ovarian cancer development impacting on MYC, WNT and AKT pathways. Oncogene. 2019 Aug;38(32):6035-6050. doi: 10.1038/s41388-019-0860-0. Epub 2019 Jul 5.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.