Molecule Information

General Information of the Molecule (ID: Mol01691)

• Name: hsa-miR-663a ,Homo sapiens
• Synonyms: microRNA 663a
• Molecule Type: Mature miRNA
• Sequence: AGGCGGGGCGCCGCGGGACCGC
• Ensembl ID: ENSG00000284419
• HGNC ID: HGNC:32919
• Mature Accession: MIMAT0003326

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.0] [2]

• Resistant Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: OE19 cells; Esophagus; Homo sapiens (Human); CVCL_1622
• In Vitro Model: kYSE410 cells; Esophagus; Homo sapiens (Human); CVCL_1352
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Chemotherapy resistant sublines were found to have specific miRNA signatures, and these miRNA signatures were different for the cisplatin vs 5-FU resistant cells from the same tumor cell line, and also for EAC vs ESCC cells with resistance to the same specific chemotherapy agent. Amongst others, miR-27b-3p, miR-193b-3p, miR-192-5p, miR-378 a-3p, miR-125a-5p and miR-18a-3p were dysregulated, consistent with negative posttranscriptional control of KRAS, TYMS, ABCC3, CBL-B and ERBB2 expression via these miRNAs.

Cyclophosphamide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Cyclophosphamide
• Molecule Alteration: Hypomethylation; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: HSPG2; Regulation; N.A.
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: BT-474 cells; Breast; Homo sapiens (Human); CVCL_0179
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: We found that miR-663 was significantly elevated in MDA-MB-231/ADM cells, and the down-regulation of miR-663 sensitized MDA-MB-231/ADM cells to both cyclophosphamide and docetaxel. The overexpression of miR-663 in breast tumor tissues was associated with chemoresistance; in MDA-MB-231 cells, this chemoresistance was accompanied by the down-regulation of HSPG2, which was identified as a target of miR-663. MDA-MB-231/ADM contained fewer methylated CpG sites than its parental cell line, and miR-663 expression in MDA-MB-231 cells was reactivated by 5-aza-29-deoxycytidine treatment, indicating that DNA methylation may play a functional role in the expression of miR-663.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Docetaxel
• Molecule Alteration: Hypomethylation; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: HSPG2; Regulation; N.A.
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: BT-474 cells; Breast; Homo sapiens (Human); CVCL_0179
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: We found that miR-663 was significantly elevated in MDA-MB-231/ADM cells, and the down-regulation of miR-663 sensitized MDA-MB-231/ADM cells to both cyclophosphamide and docetaxel. The overexpression of miR-663 in breast tumor tissues was associated with chemoresistance; in MDA-MB-231 cells, this chemoresistance was accompanied by the down-regulation of HSPG2, which was identified as a target of miR-663. MDA-MB-231/ADM contained fewer methylated CpG sites than its parental cell line, and miR-663 expression in MDA-MB-231 cells was reactivated by 5-aza-29-deoxycytidine treatment, indicating that DNA methylation may play a functional role in the expression of miR-663.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [4]

• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: T3-M4 cells; Pancreas; Homo sapiens (Human); CVCL_VQ95
• Experiment for Molecule Alteration: RT-PCR, qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay; Flow cytometry assay
• Mechanism Description: Upregulated miR-663 expression in PDAC cell lines promotes sensitivity to GEM.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [5]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: IOSE386 cells; Ovary; Homo sapiens (Human); CVCL_E230
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: TUOC1 cells; Ovary; Homo sapiens (Human); CVCL_L700
• In Vitro Model: OVCAR-3 cells; Ascites; Homo sapiens (Human); CVCL_0465
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• In Vitro Model: C13 cells; Ovary; Homo sapiens (Human); CVCL_0114
• In Vitro Model: KK cells; Ascites; Homo sapiens (Human); CVCL_F844
• In Vitro Model: KOC7C cells; Pleural effusion; Homo sapiens (Human); CVCL_5307
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Seventeen miRNAs were overexpressed in Taxol-resistant cells, including miR-663, miR-622, and HS_188

Sorafenib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [6]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Sorafenib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: RT-PCR; Western blot; Luciferase assay
• Experiment for Drug Resistance: Cytotoxicity assay; Apoptosis assays
• Mechanism Description: Cellular expression of full-length HCV increases sensitivity to sorafenib by the miRNA-dependent modulation of Mcl-1 and apoptosis.

Clinical Trial Drug(s) 1 drug(s) in total

OSI-027

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [4]

• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: OSI-027
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: T3-M4 cells; Pancreas; Homo sapiens (Human); CVCL_VQ95
• Experiment for Molecule Alteration: RT-PCR, qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay; Flow cytometry assay
• Mechanism Description: Gemcitabine enhances OSI-027 cytotoxicity by upregulation of miR-663a in pancreatic ductal adenocarcinoma cells.

References

• Ref 1: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 2: The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
• Ref 3: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 4: Gemcitabine enhances OSI-027 cytotoxicity by upregulation of miR-663a in pancreatic ductal adenocarcinoma cells. Am J Transl Res. 2019 Jan 15;11(1):473-485. eCollection 2019.
• Ref 5: Overcoming acquired BRAF inhibitor resistance in melanoma via targeted inhibition of Hsp90 with ganetespibMol Cancer Ther. 2014 Feb;13(2):353-63. doi: 10.1158/1535-7163.MCT-13-0481. Epub 2014 Jan 7.
• Ref 6: Downregulation of miR-21 enhances chemotherapeutic effect of taxol in breast carcinoma cells. Technol Cancer Res Treat. 2010 Feb;9(1):77-86. doi: 10.1177/153303461000900109.