Molecule Information
General Information of the Molecule (ID: Mol01691)
| Name |
hsa-miR-663a
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 663a
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
AGGCGGGGCGCCGCGGGACCGC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | [1] | |||
| Sensitive Disease | Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | |||
| Sensitive Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | BxPC-3 cells | Pancreas | Homo sapiens (Human) | CVCL_0186 |
| MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 | |
| PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 | |
| T3-M4 cells | Pancreas | Homo sapiens (Human) | CVCL_VQ95 | |
| Experiment for Molecule Alteration |
RT-PCR, qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Colony formation assay; Flow cytometry assay | |||
| Mechanism Description | Upregulated miR-663 expression in PDAC cell lines promotes sensitivity to GEM. | |||
Clinical Trial Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | [1] | |||
| Sensitive Disease | Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | |||
| Sensitive Drug | OSI-027 | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | BxPC-3 cells | Pancreas | Homo sapiens (Human) | CVCL_0186 |
| MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 | |
| PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 | |
| T3-M4 cells | Pancreas | Homo sapiens (Human) | CVCL_VQ95 | |
| Experiment for Molecule Alteration |
RT-PCR, qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Colony formation assay; Flow cytometry assay | |||
| Mechanism Description | Gemcitabine enhances OSI-027 cytotoxicity by upregulation of miR-663a in pancreatic ductal adenocarcinoma cells. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
