Molecule Information
General Information of the Molecule (ID: Mol01691)
Name |
hsa-miR-663a
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 663a
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AGGCGGGGCGCCGCGGGACCGC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Pancreatic ductal adenocarcinoma | [1] | |||
Sensitive Disease | Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | |||
Sensitive Drug | Gemcitabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | BxPC-3 cells | Pancreas | Homo sapiens (Human) | CVCL_0186 |
MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 | |
PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 | |
T3-M4 cells | Pancreas | Homo sapiens (Human) | CVCL_VQ95 | |
Experiment for Molecule Alteration |
RT-PCR, qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Colony formation assay; Flow cytometry assay | |||
Mechanism Description | Upregulated miR-663 expression in PDAC cell lines promotes sensitivity to GEM. |
Clinical Trial Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Pancreatic ductal adenocarcinoma | [1] | |||
Sensitive Disease | Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | |||
Sensitive Drug | OSI-027 | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | BxPC-3 cells | Pancreas | Homo sapiens (Human) | CVCL_0186 |
MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 | |
PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 | |
T3-M4 cells | Pancreas | Homo sapiens (Human) | CVCL_VQ95 | |
Experiment for Molecule Alteration |
RT-PCR, qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Colony formation assay; Flow cytometry assay | |||
Mechanism Description | Gemcitabine enhances OSI-027 cytotoxicity by upregulation of miR-663a in pancreatic ductal adenocarcinoma cells. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.