General Information of the Molecule (ID: Mol01691)
Name
hsa-miR-663a ,Homo sapiens
Synonyms
microRNA 663a
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AGGCGGGGCGCCGCGGGACCGC
    Click to Show/Hide
Ensembl ID
ENSG00000284419
HGNC ID
HGNC:32919
Mature Accession
MIMAT0003326
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [1]
Sensitive Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
T3-M4 cells Pancreas Homo sapiens (Human) CVCL_VQ95
Experiment for
Molecule Alteration
RT-PCR, qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Colony formation assay; Flow cytometry assay
Mechanism Description Upregulated miR-663 expression in PDAC cell lines promotes sensitivity to GEM.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
OSI-027
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [1]
Sensitive Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
Sensitive Drug OSI-027
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
T3-M4 cells Pancreas Homo sapiens (Human) CVCL_VQ95
Experiment for
Molecule Alteration
RT-PCR, qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Colony formation assay; Flow cytometry assay
Mechanism Description Gemcitabine enhances OSI-027 cytotoxicity by upregulation of miR-663a in pancreatic ductal adenocarcinoma cells.
References
Ref 1 Gemcitabine enhances OSI-027 cytotoxicity by upregulation of miR-663a in pancreatic ductal adenocarcinoma cells. Am J Transl Res. 2019 Jan 15;11(1):473-485. eCollection 2019.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.