Molecule Information
General Information of the Molecule (ID: Mol01688)
Name |
hsa-miR-647
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 647
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
GUGGCUGCACUCACUUCCUUC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [1] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Vincristine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
In Vitro Model | GES-1 cells | Gastric | Homo sapiens (Human) | CVCL_EQ22 |
SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
Flow cytometry assay; Wound healing and transwell assay | |||
Mechanism Description | Overexpression of miR647 sensitizes tumors to chemotherapy in vivo by reducing the expression levels of ANk2, FAk, MMP2, MMP12, CD44 and SNAIL1. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.