Molecule Information
General Information of the Molecule (ID: Mol01688)
| Name |
hsa-miR-647
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 647
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
GUGGCUGCACUCACUUCCUUC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| In Vitro Model | GES-1 cells | Gastric | Homo sapiens (Human) | CVCL_EQ22 |
| SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay; Wound healing and transwell assay | |||
| Mechanism Description | Overexpression of miR647 sensitizes tumors to chemotherapy in vivo by reducing the expression levels of ANk2, FAk, MMP2, MMP12, CD44 and SNAIL1. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
