General Information of the Molecule (ID: Mol01684)
Name
hsa-miR-634 ,Homo sapiens
Synonyms
microRNA 634
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AACCAGCACCCCAACUUUGGAC
    Click to Show/Hide
Ensembl ID
ENSG00000207943
HGNC ID
HGNC:32890
Mature Accession
MIMAT0003304
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Click to Show/Hide the Full List of Drugs
Carboplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [1]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Carboplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
MAPK/RAS signaling pathway Regulation hsa04010
In Vitro Model A2780 cells Ovary Homo sapiens (Human) CVCL_0134
T24 cells Bladder Homo sapiens (Human) CVCL_0554
HCT8 cells Colon Homo sapiens (Human) CVCL_2478
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-634 is an important player in cisplatin-resistance. First of all, miR-634 was the only miR miR-634 overexpression in ovarian cancer cell lines and patient samples negatively regulates important cell-cycle genes (CCND1) and Ras-MAPk pathway components (GRB2, ERk2, RSk1 and RSk2). Inhibition of the Ras-MAPk pathway resulted in increased sensitivity to cisplatin, suggesting that the miR-634-mediated repression of this pathway is responsible for the effect of miR-634 on cisplatin resistance.
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [1]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
MAPK/RAS signaling pathway Regulation hsa04010
In Vitro Model A2780 cells Ovary Homo sapiens (Human) CVCL_0134
T24 cells Bladder Homo sapiens (Human) CVCL_0554
HCT8 cells Colon Homo sapiens (Human) CVCL_2478
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-634 is an important player in cisplatin-resistance. First of all, miR-634 was the only miR miR-634 overexpression in ovarian cancer cell lines and patient samples negatively regulates important cell-cycle genes (CCND1) and Ras-MAPk pathway components (GRB2, ERk2, RSk1 and RSk2). Inhibition of the Ras-MAPk pathway resulted in increased sensitivity to cisplatin, suggesting that the miR-634-mediated repression of this pathway is responsible for the effect of miR-634 on cisplatin resistance.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [1]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
MAPK/RAS signaling pathway Regulation hsa04010
In Vitro Model A2780 cells Ovary Homo sapiens (Human) CVCL_0134
T24 cells Bladder Homo sapiens (Human) CVCL_0554
HCT8 cells Colon Homo sapiens (Human) CVCL_2478
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-634 is an important player in cisplatin-resistance. First of all, miR-634 was the only miR miR-634 overexpression in ovarian cancer cell lines and patient samples negatively regulates important cell-cycle genes (CCND1) and Ras-MAPk pathway components (GRB2, ERk2, RSk1 and RSk2). Inhibition of the Ras-MAPk pathway resulted in increased sensitivity to cisplatin, suggesting that the miR-634-mediated repression of this pathway is responsible for the effect of miR-634 on cisplatin resistance.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Nasopharyngeal carcinoma [2]
Sensitive Disease Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model CNE1 cells Throat Homo sapiens (Human) CVCL_6888
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-634 most significantly downregulated in the paclitaxel-resistant CNE-1/Taxol, in regulating the paclitaxel sensitivity in NPC cells. miR-634 expression in the CNE-1/Taxol cells by lentivirus infection, miR-634 re-sensitized the CNE-1/Taxol cells to paclitaxel in vitro. In xenograft mouse model, miR-634 inhibited tumor growth and (+) paclitaxel sensitivity.
Temozolomide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioma [3]
Resistant Disease Glioma [ICD-11: 2A00.1]
Resistant Drug Temozolomide
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell colony Inhibition hsa05200
Cell invasion Inhibition hsa05200
Cell viability Inhibition hsa05200
RAF/ERK signaling pathway Activation hsa04010
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description Overexpression of CYR61 increased the survival rate of U251/TMZ and U87/TMZ cells after TMZ treatment, while induction of miR-634 significantly suppressed the survival of U251/TMZ and U87/TMZ cells after TMZ treatment.
References
Ref 1 miR-634 restores drug sensitivity in resistant ovarian cancer cells by targeting the Ras-MAPK pathway. Mol Cancer. 2015 Nov 17;14:196. doi: 10.1186/s12943-015-0464-4.
Ref 2 MiR-634 sensitizes nasopharyngeal carcinoma cells to paclitaxel and inhibits cell growth both in vitro and in vivo. Int J Clin Exp Pathol. 2014 Sep 15;7(10):6784-91. eCollection 2014.
Ref 3 MiR-634 sensitizes glioma cells to temozolomide by targeting CYR61 through Raf-ERK signaling pathway. Cancer Med. 2018 Mar;7(3):913-921. doi: 10.1002/cam4.1351. Epub 2018 Feb 23.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.