Molecule Information

General Information of the Molecule (ID: Mol01683)

Name	hsa-miR-633 ,Homo sapiens
Synonyms	microRNA 33b Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	CUAAUAGUAUCUACCACAAUAAA Click to Show/Hide
Ensembl ID	ENSG00000207839
HGNC ID	HGNC:32791
Mature Accession	MIMAT0003303
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Gastric cancer				[1]
Resistant Disease	Gastric cancer [ICD-11: 2B72.1]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell invasion		Activation	hsa05200
	Cell proliferation		Activation	hsa05200
In Vitro Model	SGC7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	Flow cytometry assay
Mechanism Description	miR-633 regulates chemotherapy resistance through downregulating FADD in gastric tumor cells.

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Gastric cancer				[1]
Resistant Disease	Gastric cancer [ICD-11: 2B72.1]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell invasion		Activation	hsa05200
	Cell proliferation		Activation	hsa05200
In Vitro Model	SGC7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	Flow cytometry assay
Mechanism Description	miR-633 regulates chemotherapy resistance through downregulating FADD in gastric tumor cells.

References

Ref 1	Foxo3a-dependent miR-633 regulates chemotherapeutic sensitivity in gastric cancer by targeting Fas-associated death domain. RNA Biol. 2019 Feb;16(2):233-248. doi: 10.1080/15476286.2019.1565665. Epub 2019 Jan 22.