General Information of the Molecule (ID: Mol01683)
Name
hsa-miR-633 ,Homo sapiens
Synonyms
microRNA 33b
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CUAAUAGUAUCUACCACAAUAAA
    Click to Show/Hide
Ensembl ID
ENSG00000207839
HGNC ID
HGNC:32791
Mature Accession
MIMAT0003303
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell proliferation Activation hsa05200
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description miR-633 regulates chemotherapy resistance through downregulating FADD in gastric tumor cells.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell proliferation Activation hsa05200
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description miR-633 regulates chemotherapy resistance through downregulating FADD in gastric tumor cells.
References
Ref 1 Foxo3a-dependent miR-633 regulates chemotherapeutic sensitivity in gastric cancer by targeting Fas-associated death domain. RNA Biol. 2019 Feb;16(2):233-248. doi: 10.1080/15476286.2019.1565665. Epub 2019 Jan 22.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.