Molecule Information
General Information of the Molecule (ID: Mol01682)
| Name |
hsa-miR-33b-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 33b
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
GUGCAUUGCUGUUGCAUUGC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| GES-1 cells | Gastric | Homo sapiens (Human) | CVCL_EQ22 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Colony formation assay; Flow cytometric apoptosis assay | |||
| Mechanism Description | miR33b-5p sensitizes gastric cancer cells to chemotherapy drugs via inhibiting HMGA2 expression. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Docetaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| GES-1 cells | Gastric | Homo sapiens (Human) | CVCL_EQ22 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Colony formation assay; Flow cytometric apoptosis assay | |||
| Mechanism Description | miR33b-5p sensitizes gastric cancer cells to chemotherapy drugs via inhibiting HMGA2 expression. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
