Molecule Information

General Information of the Molecule (ID: Mol01682)

• Name: hsa-miR-33b-5p ,Homo sapiens
• Synonyms: microRNA 33b
• Molecule Type: Mature miRNA
• Sequence: GUGCAUUGCUGUUGCAUUGC
• Ensembl ID: ENSG00000207839
• HGNC ID: HGNC:32791
• Mature Accession: MIMAT0003301

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: GES-1 cells; Gastric; Homo sapiens (Human); CVCL_EQ22
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay; Flow cytometric apoptosis assay
• Mechanism Description: miR33b-5p sensitizes gastric cancer cells to chemotherapy drugs via inhibiting HMGA2 expression.

Docetaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: GES-1 cells; Gastric; Homo sapiens (Human); CVCL_EQ22
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay; Flow cytometric apoptosis assay
• Mechanism Description: miR33b-5p sensitizes gastric cancer cells to chemotherapy drugs via inhibiting HMGA2 expression.

References

• Ref 1: MiR-33b-5p sensitizes gastric cancer cells to chemotherapy drugs via inhibiting HMGA2 expression. J Drug Target. 2017 Aug;25(7):653-660. doi: 10.1080/1061186X.2017.1323220. Epub 2017 May 11.