General Information of the Molecule (ID: Mol01682)
Name
hsa-miR-33b-5p ,Homo sapiens
Synonyms
microRNA 33b
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
GUGCAUUGCUGUUGCAUUGC
    Click to Show/Hide
Ensembl ID
ENSG00000207839
HGNC ID
HGNC:32791
Mature Accession
MIMAT0003301
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
GES-1 cells Gastric Homo sapiens (Human) CVCL_EQ22
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Colony formation assay; Flow cytometric apoptosis assay
Mechanism Description miR33b-5p sensitizes gastric cancer cells to chemotherapy drugs via inhibiting HMGA2 expression.
Docetaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
GES-1 cells Gastric Homo sapiens (Human) CVCL_EQ22
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Colony formation assay; Flow cytometric apoptosis assay
Mechanism Description miR33b-5p sensitizes gastric cancer cells to chemotherapy drugs via inhibiting HMGA2 expression.
References
Ref 1 MiR-33b-5p sensitizes gastric cancer cells to chemotherapy drugs via inhibiting HMGA2 expression. J Drug Target. 2017 Aug;25(7):653-660. doi: 10.1080/1061186X.2017.1323220. Epub 2017 May 11.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.