Molecule Information
General Information of the Molecule (ID: Mol01680)
| Name |
hsa-miR-630
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 630
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
AGUAUUCUGUACCAGGGAAGGU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [1] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Afatinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| In Vitro Model | SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 |
| HCC1954 cells | Breast | Homo sapiens (Human) | CVCL_1259 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Introducing miR-630 into cells with innate- or acquired- resistance to HER-drugs significantly restored the efficacy of lapatinib, neratinib and afatinib; through a mechanism that at least partly, involve miR-630's regulation of IGF1R. Blocking miR-630 induced resistance/insensitivity to these drugs. Cellular motility, invasion, and anoikis were also observed as significantly altered by miR-630 manipulation, whereby introducing miR-630 into cells reduced cellular aggression while inhibition of miR-630 induced a more aggressive cellular phenotype. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [2] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell viability | Activation | hsa05200 | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| NCI-H358 cells | Lung | Homo sapiens (Human) | CVCL_1559 | |
| CL1-0 cells | Lung | Homo sapiens (Human) | CVCL_3871 | |
| H23 cells | Lung | Homo sapiens (Human) | CVCL_1547 | |
| TL4 cells | Lung | Homo sapiens (Human) | N.A. | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | Patients with tumors expressing low miR-630, high Bcl-2, and a combination of both were more likely than their counterparts to show unfavorable responses to cisplatin-based chemotherapy. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] | [3] | |||
| Resistant Disease | Lung adenocarcinoma [ICD-11: 2C25.0] | |||
| Resistant Drug | Gefitinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell viability | Activation | hsa05200 | ||
| miR630/YAP1/ERK signaling pathway | Regulation | N.A. | ||
| In Vitro Model | PC9 cells | Lung | Homo sapiens (Human) | CVCL_B260 |
| PC9GR cells | Lung | Homo sapiens (Human) | CVCL_V337 | |
| CL97 cells | Lung | Homo sapiens (Human) | CVCL_N826 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | Low miR-630 and high YAP1 mRNA levels are associated with unfavorable response to TkI therapy in lung adenocarcinoma patients. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [1] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Lapatinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| In Vitro Model | SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 |
| HCC1954 cells | Breast | Homo sapiens (Human) | CVCL_1259 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Introducing miR-630 into cells with innate- or acquired- resistance to HER-drugs significantly restored the efficacy of lapatinib, neratinib and afatinib; through a mechanism that at least partly, involve miR-630's regulation of IGF1R. Blocking miR-630 induced resistance/insensitivity to these drugs. Cellular motility, invasion, and anoikis were also observed as significantly altered by miR-630 manipulation, whereby introducing miR-630 into cells reduced cellular aggression while inhibition of miR-630 induced a more aggressive cellular phenotype. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [1] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Neratinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| In Vitro Model | SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 |
| HCC1954 cells | Breast | Homo sapiens (Human) | CVCL_1259 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Introducing miR-630 into cells with innate- or acquired- resistance to HER-drugs significantly restored the efficacy of lapatinib, neratinib and afatinib; through a mechanism that at least partly, involve miR-630's regulation of IGF1R. Blocking miR-630 induced resistance/insensitivity to these drugs. Cellular motility, invasion, and anoikis were also observed as significantly altered by miR-630 manipulation, whereby introducing miR-630 into cells reduced cellular aggression while inhibition of miR-630 induced a more aggressive cellular phenotype. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [4] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell migration | Activation | hsa04670 | |
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Wound healing assay; Invasion assay; CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | miR-630 inhibitor attenuated chemoresistant epithelial ovarian cancer proliferation and invasion, probably by targeting APAF-1, re-sensitizing the cells to chemotherapy. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
