Molecule Information

General Information of the Molecule (ID: Mol01680)

• Name: hsa-miR-630 ,Homo sapiens
• Synonyms: microRNA 630
• Molecule Type: Mature miRNA
• Sequence: AGUAUUCUGUACCAGGGAAGGU
• Ensembl ID: ENSG00000283798
• HGNC ID: HGNC:32886
• Mature Accession: MIMAT0003299

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Afatinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Afatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: HCC1954 cells; Breast; Homo sapiens (Human); CVCL_1259
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Introducing miR-630 into cells with innate- or acquired- resistance to HER-drugs significantly restored the efficacy of lapatinib, neratinib and afatinib; through a mechanism that at least partly, involve miR-630's regulation of IGF1R. Blocking miR-630 induced resistance/insensitivity to these drugs. Cellular motility, invasion, and anoikis were also observed as significantly altered by miR-630 manipulation, whereby introducing miR-630 into cells reduced cellular aggression while inhibition of miR-630 induced a more aggressive cellular phenotype.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [2]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCI-H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• In Vitro Model: CL1-0 cells; Lung; Homo sapiens (Human); CVCL_3871
• In Vitro Model: H23 cells; Lung; Homo sapiens (Human); CVCL_1547
• In Vitro Model: TL4 cells; Lung; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Patients with tumors expressing low miR-630, high Bcl-2, and a combination of both were more likely than their counterparts to show unfavorable responses to cisplatin-based chemotherapy.

Gefitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [3]

• Resistant Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Resistant Drug: Gefitinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: miR630/YAP1/ERK signaling pathway; Regulation; hsa05206
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• In Vitro Model: PC9GR cells; Lung; Homo sapiens (Human); CVCL_V337
• In Vitro Model: CL97 cells; Lung; Homo sapiens (Human); CVCL_N826
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Low miR-630 and high YAP1 mRNA levels are associated with unfavorable response to TkI therapy in lung adenocarcinoma patients.

Lapatinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Lapatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: HCC1954 cells; Breast; Homo sapiens (Human); CVCL_1259
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Introducing miR-630 into cells with innate- or acquired- resistance to HER-drugs significantly restored the efficacy of lapatinib, neratinib and afatinib; through a mechanism that at least partly, involve miR-630's regulation of IGF1R. Blocking miR-630 induced resistance/insensitivity to these drugs. Cellular motility, invasion, and anoikis were also observed as significantly altered by miR-630 manipulation, whereby introducing miR-630 into cells reduced cellular aggression while inhibition of miR-630 induced a more aggressive cellular phenotype.

Neratinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Neratinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: HCC1954 cells; Breast; Homo sapiens (Human); CVCL_1259
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Introducing miR-630 into cells with innate- or acquired- resistance to HER-drugs significantly restored the efficacy of lapatinib, neratinib and afatinib; through a mechanism that at least partly, involve miR-630's regulation of IGF1R. Blocking miR-630 induced resistance/insensitivity to these drugs. Cellular motility, invasion, and anoikis were also observed as significantly altered by miR-630 manipulation, whereby introducing miR-630 into cells reduced cellular aggression while inhibition of miR-630 induced a more aggressive cellular phenotype.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [4]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Wound healing assay; Invasion assay; CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-630 inhibitor attenuated chemoresistant epithelial ovarian cancer proliferation and invasion, probably by targeting APAF-1, re-sensitizing the cells to chemotherapy.

References

• Ref 1: miR-630 targets IGF1R to regulate response to HER-targeting drugs and overall cancer cell progression in HER2 over-expressing breast cancer. Mol Cancer. 2014 Mar 24;13:71. doi: 10.1186/1476-4598-13-71.
• Ref 2: MicroRNA-630 may confer favorable cisplatin-based chemotherapy and clinical outcomes in non-small cell lung cancer by targeting Bcl-2. Oncotarget. 2018 Feb 9;9(17):13758-13767. doi: 10.18632/oncotarget.24474. eCollection 2018 Mar 2.
• Ref 3: A low microRNA-630 expression confers resistance to tyrosine kinase inhibitors in EGFR-mutated lung adenocarcinomas via miR-630/YAP1/ERK feedback loop. Theranostics. 2018 Feb 2;8(5):1256-1269. doi: 10.7150/thno.22048. eCollection 2018.
• Ref 4: MicroRNA-630 inhibitor sensitizes chemoresistant ovarian cancer to chemotherapy by enhancing apoptosis. Biochem Biophys Res Commun. 2018 Mar 4;497(2):513-520. doi: 10.1016/j.bbrc.2018.02.062. Epub 2018 Feb 13.