Molecule Information

General Information of the Molecule (ID: Mol01680)
Name
hsa-miR-630 ,Homo sapiens
Synonyms
microRNA 630
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AGUAUUCUGUACCAGGGAAGGU
    Click to Show/Hide
Ensembl ID
ENSG00000283798
HGNC ID
HGNC:32886
Mature Accession
MIMAT0003299
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
Click to Show/Hide the Full List of Drugs
Afatinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [1]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Afatinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
In Vitro Model SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
HCC1954 cells Breast Homo sapiens (Human) CVCL_1259
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Introducing miR-630 into cells with innate- or acquired- resistance to HER-drugs significantly restored the efficacy of lapatinib, neratinib and afatinib; through a mechanism that at least partly, involve miR-630's regulation of IGF1R. Blocking miR-630 induced resistance/insensitivity to these drugs. Cellular motility, invasion, and anoikis were also observed as significantly altered by miR-630 manipulation, whereby introducing miR-630 into cells reduced cellular aggression while inhibition of miR-630 induced a more aggressive cellular phenotype.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [2]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H1299 cells Lung Homo sapiens (Human) CVCL_0060
NCI-H358 cells Lung Homo sapiens (Human) CVCL_1559
CL1-0 cells Lung Homo sapiens (Human) CVCL_3871
H23 cells Lung Homo sapiens (Human) CVCL_1547
TL4 cells Lung Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description Patients with tumors expressing low miR-630, high Bcl-2, and a combination of both were more likely than their counterparts to show unfavorable responses to cisplatin-based chemotherapy.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [3]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 Microarray analysis; qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MiRNA microarray analysis showed that there were 53 upregulated miRNAs in Huh-7/ADM, 56 in Huh-7/CBP, 58 in Huh-7/DDP, 58 in Huh-7/MMC and 49 in Huh-7/VCR, whereas there were 52 downregulated miRNAs in Huh-7/ADM, 50 in Huh-7/CBP, 41 in Huh-7/DDP, 55 in Huh-7/MMC and 56 in Huh-7/VCR. Moreover, 26 simultaneously upregulated and 25 simultaneously downregulated miRNAs were noted in the Huh-7/ADM, Huh-7/CBP, Huh-7/DDP and Huh-7/MMC sublines compared to the parental Huh-7 cell line. In contrast, among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. In conclusion, the present study demonstrates that the differentially expressed miRNA profiles in these five drug-resistant HCC sublines could be useful to further investigate the association of miRNA expression with drug resistance in HCC.
Gefitinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [4]
Resistant Disease Lung adenocarcinoma [ICD-11: 2C25.0]
 Disease Info 
Resistant Drug Gefitinib
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
miR630/YAP1/ERK signaling pathway Regulation N.A.
In Vitro Model PC9 cells Lung Homo sapiens (Human) CVCL_B260
PC9GR cells Lung Homo sapiens (Human) CVCL_V337
CL97 cells Lung Homo sapiens (Human) CVCL_N826
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description Low miR-630 and high YAP1 mRNA levels are associated with unfavorable response to TkI therapy in lung adenocarcinoma patients.
Lapatinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [1]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Lapatinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
In Vitro Model SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
HCC1954 cells Breast Homo sapiens (Human) CVCL_1259
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Introducing miR-630 into cells with innate- or acquired- resistance to HER-drugs significantly restored the efficacy of lapatinib, neratinib and afatinib; through a mechanism that at least partly, involve miR-630's regulation of IGF1R. Blocking miR-630 induced resistance/insensitivity to these drugs. Cellular motility, invasion, and anoikis were also observed as significantly altered by miR-630 manipulation, whereby introducing miR-630 into cells reduced cellular aggression while inhibition of miR-630 induced a more aggressive cellular phenotype.
Mitomycin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [3]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
 Disease Info 
Resistant Drug Mitomycin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 Microarray analysis; qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MiRNA microarray analysis showed that there were 53 upregulated miRNAs in Huh-7/ADM, 56 in Huh-7/CBP, 58 in Huh-7/DDP, 58 in Huh-7/MMC and 49 in Huh-7/VCR, whereas there were 52 downregulated miRNAs in Huh-7/ADM, 50 in Huh-7/CBP, 41 in Huh-7/DDP, 55 in Huh-7/MMC and 56 in Huh-7/VCR. Moreover, 26 simultaneously upregulated and 25 simultaneously downregulated miRNAs were noted in the Huh-7/ADM, Huh-7/CBP, Huh-7/DDP and Huh-7/MMC sublines compared to the parental Huh-7 cell line. In contrast, among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. In conclusion, the present study demonstrates that the differentially expressed miRNA profiles in these five drug-resistant HCC sublines could be useful to further investigate the association of miRNA expression with drug resistance in HCC.
Neratinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [1]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Neratinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
In Vitro Model SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
HCC1954 cells Breast Homo sapiens (Human) CVCL_1259
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Introducing miR-630 into cells with innate- or acquired- resistance to HER-drugs significantly restored the efficacy of lapatinib, neratinib and afatinib; through a mechanism that at least partly, involve miR-630's regulation of IGF1R. Blocking miR-630 induced resistance/insensitivity to these drugs. Cellular motility, invasion, and anoikis were also observed as significantly altered by miR-630 manipulation, whereby introducing miR-630 into cells reduced cellular aggression while inhibition of miR-630 induced a more aggressive cellular phenotype.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [5]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell migration Activation hsa04670
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Wound healing assay; Invasion assay; CCK8 assay; Flow cytometry assay
Mechanism Description miR-630 inhibitor attenuated chemoresistant epithelial ovarian cancer proliferation and invasion, probably by targeting APAF-1, re-sensitizing the cells to chemotherapy.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [3]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
 Disease Info 
Resistant Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 Microarray analysis; qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MiRNA microarray analysis showed that there were 53 upregulated miRNAs in Huh-7/ADM, 56 in Huh-7/CBP, 58 in Huh-7/DDP, 58 in Huh-7/MMC and 49 in Huh-7/VCR, whereas there were 52 downregulated miRNAs in Huh-7/ADM, 50 in Huh-7/CBP, 41 in Huh-7/DDP, 55 in Huh-7/MMC and 56 in Huh-7/VCR. Moreover, 26 simultaneously upregulated and 25 simultaneously downregulated miRNAs were noted in the Huh-7/ADM, Huh-7/CBP, Huh-7/DDP and Huh-7/MMC sublines compared to the parental Huh-7 cell line. In contrast, among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. In conclusion, the present study demonstrates that the differentially expressed miRNA profiles in these five drug-resistant HCC sublines could be useful to further investigate the association of miRNA expression with drug resistance in HCC.
References
Ref 1 miR-630 targets IGF1R to regulate response to HER-targeting drugs and overall cancer cell progression in HER2 over-expressing breast cancer. Mol Cancer. 2014 Mar 24;13:71. doi: 10.1186/1476-4598-13-71.
Ref 2 MicroRNA-630 may confer favorable cisplatin-based chemotherapy and clinical outcomes in non-small cell lung cancer by targeting Bcl-2. Oncotarget. 2018 Feb 9;9(17):13758-13767. doi: 10.18632/oncotarget.24474. eCollection 2018 Mar 2.
Ref 3 Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
Ref 4 A low microRNA-630 expression confers resistance to tyrosine kinase inhibitors in EGFR-mutated lung adenocarcinomas via miR-630/YAP1/ERK feedback loop. Theranostics. 2018 Feb 2;8(5):1256-1269. doi: 10.7150/thno.22048. eCollection 2018.
Ref 5 MicroRNA-630 inhibitor sensitizes chemoresistant ovarian cancer to chemotherapy by enhancing apoptosis. Biochem Biophys Res Commun. 2018 Mar 4;497(2):513-520. doi: 10.1016/j.bbrc.2018.02.062. Epub 2018 Feb 13.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.