Molecule Information
General Information of the Molecule (ID: Mol01679)
Name |
hsa-miR-623
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 623
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AUCCCUUGCAGGGGCUGUUGGGU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [1] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | The restored miR-623 expression could inhibit the proliferation of GC cells and enhance their chemosensitivity to 5-FU via the cell apoptosis pathway and the recovered CCND1 expression counteracted the effects of miR-623 on GC cell proliferation, chemosensitivity, and 5-FU-induced apoptosis. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.