General Information of the Molecule (ID: Mol01679)
Name
hsa-miR-623 ,Homo sapiens
Synonyms
microRNA 623
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AUCCCUUGCAGGGGCUGUUGGGU
    Click to Show/Hide
Ensembl ID
ENSG00000207719
HGNC ID
HGNC:32879
Mature Accession
MIMAT0003292
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description The restored miR-623 expression could inhibit the proliferation of GC cells and enhance their chemosensitivity to 5-FU via the cell apoptosis pathway and the recovered CCND1 expression counteracted the effects of miR-623 on GC cell proliferation, chemosensitivity, and 5-FU-induced apoptosis.
References
Ref 1 MicroRNA-623 Targets Cyclin D1 to Inhibit Cell Proliferation and Enhance the Chemosensitivity of Cells to 5-Fluorouracil in Gastric Cancer. Oncol Res. 2018 Dec 27;27(1):19-27. doi: 10.3727/096504018X15193469240508. Epub 2018 Mar 1.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.