Molecule Information

General Information of the Molecule (ID: Mol01679)

• Name: hsa-miR-623 ,Homo sapiens
• Synonyms: microRNA 623
• Molecule Type: Mature miRNA
• Sequence: AUCCCUUGCAGGGGCUGUUGGGU
• Ensembl ID: ENSG00000207719
• HGNC ID: HGNC:32879
• Mature Accession: MIMAT0003292

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: The restored miR-623 expression could inhibit the proliferation of GC cells and enhance their chemosensitivity to 5-FU via the cell apoptosis pathway and the recovered CCND1 expression counteracted the effects of miR-623 on GC cell proliferation, chemosensitivity, and 5-FU-induced apoptosis.

References

• Ref 1: MicroRNA-623 Targets Cyclin D1 to Inhibit Cell Proliferation and Enhance the Chemosensitivity of Cells to 5-Fluorouracil in Gastric Cancer. Oncol Res. 2018 Dec 27;27(1):19-27. doi: 10.3727/096504018X15193469240508. Epub 2018 Mar 1.