Molecule Information

General Information of the Molecule (ID: Mol01675)

• Name: hsa-miR-591 ,Homo sapiens
• Synonyms: microRNA 591
• Molecule Type: Mature miRNA
• Sequence: AGACCAUGGGUUCUCAUUGU
• Ensembl ID: ENSG00000208025
• HGNC ID: HGNC:32847
• Mature Accession: MIMAT0003259

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: TUNEL assay
• Mechanism Description: miR-106a and miR-591 have important roles in conferring PTX resistance to ovarian cancer cells. Modulation of these microRNAs resensitizes PTX-resistant cancer cells by targeting BCL10, caspase-7, and ZEB1.

References

• Ref 1: Dysregulation of miR-106a and miR-591 confers paclitaxel resistance to ovarian cancer. Br J Cancer. 2013 Jul 23;109(2):452-61. doi: 10.1038/bjc.2013.305. Epub 2013 Jun 27.