Molecule Information
General Information of the Molecule (ID: Mol01674)
| Name |
hsa-miR-590-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 590
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
GAGCUUAUUCAUAAAAGUGCAG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | AKT/ERK signaling pathway | Activation | hsa04010 | |
| In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
| MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 | |
| MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 | |
| MkN28 cells | Gastric | Homo sapiens (Human) | CVCL_1416 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay; Matrigel transwell assay | |||
| Mechanism Description | miR590-5p regulates gastric cancer cell growth and chemosensitivity through RECk and the AkT/ERk pathway. RECk is a direct target of miR590-5p, knockdown of RECk accelerated cell proliferation and motility and decreased the drug sensitivity.The AkT/ERk and STAT3 signaling pathways were activated by miR590-5p overexpression. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [2] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| Hippo signaling pathway | Regulation | N.A. | ||
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| In Vivo Model | NU/NU nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-590-5p suppresses hepatocellular carcinoma chemoresistance by downregulating YAP1 expression. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | AKT/ERK signaling pathway | Activation | hsa04010 | |
| In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
| MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 | |
| MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 | |
| MkN28 cells | Gastric | Homo sapiens (Human) | CVCL_1416 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay; Matrigel transwell assay | |||
| Mechanism Description | miR590-5p regulates gastric cancer cell growth and chemosensitivity through RECk and the AkT/ERk pathway. RECk is a direct target of miR590-5p, knockdown of RECk accelerated cell proliferation and motility and decreased the drug sensitivity.The AkT/ERk and STAT3 signaling pathways were activated by miR590-5p overexpression. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
