Molecule Information

General Information of the Molecule (ID: Mol01671)

• Name: hsa-miR-577 ,Homo sapiens
• Synonyms: microRNA 577
• Molecule Type: Mature miRNA
• Sequence: UAGAUAAAAUAUUGGUACCUG
• Ensembl ID: ENSG00000207931
• HGNC ID: HGNC:32833
• Mature Accession: MIMAT0003242

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [1]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: CaCo2 cells; Colon; Homo sapiens (Human); CVCL_0025
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; BrdU incorporation assay; Flow cytometric analysis
• Mechanism Description: Ectopic expression of miR577 enhanced 5-FU sensitivity in SW480/5-FU cells by down-regulating HSP27. Enforced expression of HSP27 reversed the effects of miR577 on CRC cell growth and 5-FU sensitivity.

References

• Ref 1: microRNA-577 suppresses tumor growth and enhances chemosensitivity in colorectal cancer. J Biochem Mol Toxicol. 2017 Jun;31(6). doi: 10.1002/jbt.21888. Epub 2017 Feb 2.