General Information of the Molecule (ID: Mol01671)
Name
hsa-miR-577 ,Homo sapiens
Synonyms
microRNA 577
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UAGAUAAAAUAUUGGUACCUG
    Click to Show/Hide
Ensembl ID
ENSG00000207931
HGNC ID
HGNC:32833
Mature Accession
MIMAT0003242
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
SW620 cells Colon Homo sapiens (Human) CVCL_0547
CaCo2 cells Colon Homo sapiens (Human) CVCL_0025
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LOVO cells Colon Homo sapiens (Human) CVCL_0399
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; BrdU incorporation assay; Flow cytometric analysis
Mechanism Description Ectopic expression of miR577 enhanced 5-FU sensitivity in SW480/5-FU cells by down-regulating HSP27. Enforced expression of HSP27 reversed the effects of miR577 on CRC cell growth and 5-FU sensitivity.
References
Ref 1 microRNA-577 suppresses tumor growth and enhances chemosensitivity in colorectal cancer. J Biochem Mol Toxicol. 2017 Jun;31(6). doi: 10.1002/jbt.21888. Epub 2017 Feb 2.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.