Molecule Information

General Information of the Molecule (ID: Mol01667)

• Name: hsa-miR-506-3p ,Homo sapiens
• Synonyms: microRNA 506
• Molecule Type: Mature miRNA
• Sequence: UAAGGCACCCUUCUGAGUAGA
• Ensembl ID: ENSG00000207731
• HGNC ID: HGNC:32143
• Mature Accession: MIMAT0002878

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: The elevated sensitivity of PC 9GR cells to gefitinib following transfection with the miR 506 3p mimic was counteracted by the overexpression of YAP1.

References

• Ref 1: MicroRNA 506 3p reverses gefitinib resistance in non small cell lung cancer by targeting Yes associated protein 1. Mol Med Rep. 2019 Feb;19(2):1331-1339. doi: 10.3892/mmr.2018.9710. Epub 2018 Nov 29.