Molecule Information

General Information of the Molecule (ID: Mol01667)

• Name: hsa-miR-506-3p ,Homo sapiens
• Synonyms: microRNA 506
• Molecule Type: Mature miRNA
• Sequence: UAAGGCACCCUUCUGAGUAGA
• Ensembl ID: ENSG00000207731
• HGNC ID: HGNC:32143
• Mature Accession: MIMAT0002878

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: The elevated sensitivity of PC 9GR cells to gefitinib following transfection with the miR 506 3p mimic was counteracted by the overexpression of YAP1.

Paclitaxel

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [ICD-11: 2C10.0] [2]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: miR-506-3p/ZEB2/EMT axis; Regulation; N.A.
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR; Western blotting; Dual-luciferase reporter assay
• Experiment for Drug Resistance: MTT assay; Transwell assay; Cell apoptosis assay
• Mechanism Description: Taken together, downregulation of NEAT1 sensitized the GR PC cells to gemcitabine through modulation of the miR-506-3p/ZEB2/EMT axis.

References

• Ref 1: MicroRNA 506 3p reverses gefitinib resistance in non small cell lung cancer by targeting Yes associated protein 1. Mol Med Rep. 2019 Feb;19(2):1331-1339. doi: 10.3892/mmr.2018.9710. Epub 2018 Nov 29.
• Ref 2: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.