General Information of the Molecule (ID: Mol01665)
Name
hsa-miR-520h ,Homo sapiens
Synonyms
microRNA 520h
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
ACAAAGUGCUUCCCUUUAGAGU
    Click to Show/Hide
Ensembl ID
ENSG00000207861
HGNC ID
HGNC:32125
Mature Accession
MIMAT0002867
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Testicular cancer [.] [1]
Resistant Disease Testicular cancer [.]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration
RT-qPCR with "Low Density Array"
Experiment for
Drug Resistance
MTT assay
Mechanism Description Examining almost all known human micro-RNA species confirmed the miR-371-373 cluster as a promising target for explaining cisplatin resistance, potentially by counteracting wild-type P53 induced senescence or linking it with the potency to differentiate. Moreover, we describe for the first time an association of the up-regulation of micro-RNA species such as hsa-miR-512-3p/-515/-517/-518/-525 and down-regulation of hsa-miR-99a/-100/-145 with a cisplatin resistant phenotype in human germ cell tumors.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
MkN28 cells Gastric Homo sapiens (Human) CVCL_1416
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description miR-520h is up-regulated by doxorubicin to target HDAC1 and sensitizes gastric cancer cells to doxorubicin, doxorubicin down-regulates HDAC1 expression to aggravate DNA-doxorubicin interaction by inducing the expression of HDAC1-targeting miR-520h.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [3]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
T47D cells Breast Homo sapiens (Human) CVCL_0553
MDA-MB-453 cells Breast Homo sapiens (Human) CVCL_0418
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
Hs-578T cells Breast Homo sapiens (Human) CVCL_0332
HBL-100 cells Breast Homo sapiens (Human) CVCL_4362
BT483 cells Breast Homo sapiens (Human) CVCL_2319
MDA-MB-361 cells Breast Homo sapiens (Human) CVCL_0620
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay; Flow cytometry assay
Mechanism Description Through protecting cells from paclitaxel-induced apoptosis, expression of miR-520h promoted the drug resistance of human breast cancer cells. Bioinformatics prediction, compensatory mutation and functional validation further confirmed the essential role of miR-520h-suppressed Death-associated protein kinase 2 (DAPk2) expression, as restoring DAPk2 abolished miR-520h-promoted drug resistance, and knockdown of DAPk2 mitigated cell death caused by the depletion of miR-520h.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [4]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K-AKT signalling pathway Regulation N.A.
Cell cycle pathways Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Cell viability assay; Cell cycle assays; Apoptosis assay
Mechanism Description Our findings indicate that tamoxifen-resistant cells express miRNA-519a at high levels, which directly represses the expression of PTEN, RB1, and CDKN1A, central nodes of a dense network, allowing the cells to proliferate, even in the presence of tamoxifen.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [5]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Verapamil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance
MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
References
Ref 1 Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells. J Exp Clin Cancer Res. 2011 May 13;30(1):55. doi: 10.1186/1756-9966-30-55.
Ref 2 Downregulation of histone deacetylase 1 by microRNA-520h contributes to the chemotherapeutic effect of doxorubicin. FEBS Lett. 2014 Jan 3;588(1):184-91. doi: 10.1016/j.febslet.2013.11.034. Epub 2013 Dec 6.
Ref 3 miR-520h is crucial for DAPK2 regulation and breast cancer progression. Oncogene. 2016 Mar 3;35(9):1134-42. doi: 10.1038/onc.2015.168. Epub 2015 May 18.
Ref 4 Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
Ref 5 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.