Molecule Information
General Information of the Molecule (ID: Mol01665)
Name |
hsa-miR-520h
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 520h
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
ACAAAGUGCUUCCCUUUAGAGU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [1] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 |
MkN28 cells | Gastric | Homo sapiens (Human) | CVCL_1416 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTS assay | |||
Mechanism Description | miR-520h is up-regulated by doxorubicin to target HDAC1 and sensitizes gastric cancer cells to doxorubicin, doxorubicin down-regulates HDAC1 expression to aggravate DNA-doxorubicin interaction by inducing the expression of HDAC1-targeting miR-520h. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [2] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
MDA-MB-453 cells | Breast | Homo sapiens (Human) | CVCL_0418 | |
MDA-MB-468 cells | Breast | Homo sapiens (Human) | CVCL_0419 | |
Hs-578T cells | Breast | Homo sapiens (Human) | CVCL_0332 | |
HBL-100 cells | Breast | Homo sapiens (Human) | CVCL_4362 | |
BT483 cells | Breast | Homo sapiens (Human) | CVCL_2319 | |
MDA-MB-361 cells | Breast | Homo sapiens (Human) | CVCL_0620 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTS assay; Flow cytometry assay | |||
Mechanism Description | Through protecting cells from paclitaxel-induced apoptosis, expression of miR-520h promoted the drug resistance of human breast cancer cells. Bioinformatics prediction, compensatory mutation and functional validation further confirmed the essential role of miR-520h-suppressed Death-associated protein kinase 2 (DAPk2) expression, as restoring DAPk2 abolished miR-520h-promoted drug resistance, and knockdown of DAPk2 mitigated cell death caused by the depletion of miR-520h. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.