Molecule Information

General Information of the Molecule (ID: Mol01665)

• Name: hsa-miR-520h ,Homo sapiens
• Synonyms: microRNA 520h
• Molecule Type: Mature miRNA
• Sequence: ACAAAGUGCUUCCCUUUAGAGU
• Ensembl ID: ENSG00000207861
• HGNC ID: HGNC:32125
• Mature Accession: MIMAT0002867

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• In Vitro Model: MkN28 cells; Gastric; Homo sapiens (Human); CVCL_1416
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-520h is up-regulated by doxorubicin to target HDAC1 and sensitizes gastric cancer cells to doxorubicin, doxorubicin down-regulates HDAC1 expression to aggravate DNA-doxorubicin interaction by inducing the expression of HDAC1-targeting miR-520h.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: MDA-MB-453 cells; Breast; Homo sapiens (Human); CVCL_0418
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vitro Model: Hs-578T cells; Breast; Homo sapiens (Human); CVCL_0332
• In Vitro Model: HBL-100 cells; Breast; Homo sapiens (Human); CVCL_4362
• In Vitro Model: BT483 cells; Breast; Homo sapiens (Human); CVCL_2319
• In Vitro Model: MDA-MB-361 cells; Breast; Homo sapiens (Human); CVCL_0620
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay; Flow cytometry assay
• Mechanism Description: Through protecting cells from paclitaxel-induced apoptosis, expression of miR-520h promoted the drug resistance of human breast cancer cells. Bioinformatics prediction, compensatory mutation and functional validation further confirmed the essential role of miR-520h-suppressed Death-associated protein kinase 2 (DAPk2) expression, as restoring DAPk2 abolished miR-520h-promoted drug resistance, and knockdown of DAPk2 mitigated cell death caused by the depletion of miR-520h.

References

• Ref 1: Downregulation of histone deacetylase 1 by microRNA-520h contributes to the chemotherapeutic effect of doxorubicin. FEBS Lett. 2014 Jan 3;588(1):184-91. doi: 10.1016/j.febslet.2013.11.034. Epub 2013 Dec 6.
• Ref 2: miR-520h is crucial for DAPK2 regulation and breast cancer progression. Oncogene. 2016 Mar 3;35(9):1134-42. doi: 10.1038/onc.2015.168. Epub 2015 May 18.