Molecule Information
General Information of the Molecule (ID: Mol01662)
Name |
hsa-miR-519b-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 519b
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AAAGUGCAUCCUUUUAGAGGUU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [1] | |||
Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
Cell viability | Inhibition | hsa05200 | ||
In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | miR-519b-3p mimics promoted HCT116 and SW480 cells more sensitive to chemoradiation treatment while ectopic expression of ARID4B in the meantime decreased the sensitivity. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.