General Information of the Molecule (ID: Mol01662)
Name
hsa-miR-519b-3p ,Homo sapiens
Synonyms
microRNA 519b
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AAAGUGCAUCCUUUUAGAGGUU
    Click to Show/Hide
Ensembl ID
ENSG00000207825
HGNC ID
HGNC:32101
Mature Accession
MIMAT0002837
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
Cell viability Inhibition hsa05200
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR-519b-3p mimics promoted HCT116 and SW480 cells more sensitive to chemoradiation treatment while ectopic expression of ARID4B in the meantime decreased the sensitivity.
References
Ref 1 miR-519b-3p promotes responsiveness to preoperative chemoradiotherapy in rectal cancer patients by targeting ARID4B. Gene. 2018 May 20;655:84-90. doi: 10.1016/j.gene.2018.02.056. Epub 2018 Mar 22.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.