General Information of the Molecule (ID: Mol01655)
Name
hsa-miR-485-5p ,Homo sapiens
Synonyms
microRNA 485
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AGAGGCUGGCCGUGAUGAAUUC
    Click to Show/Hide
Ensembl ID
ENSG00000208027
HGNC ID
HGNC:32067
Mature Accession
MIMAT0002175
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Tongue squamous cell carcinoma [ICD-11: 2B62.1] [1]
Sensitive Disease Tongue squamous cell carcinoma [ICD-11: 2B62.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model SCC25 cells Oral Homo sapiens (Human) CVCL_1682
SCC25-res cells Tongue Homo sapiens (Human) CVCL_A5BQ
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; BrdU incorporation assay
Mechanism Description Hsa-miR485-5p reverses epithelial to mesenchymal transition and promotes cisplatin-induced cell death by targeting PAk1 in oral tongue squamous cell carcinom. Overexpression of p21 (RAC1) activated kinase 1 (PAk1) induced epithelial to mesenchymal transition (EMT) and significantly promoted the invasion and migration of oral squamous cell carcinoma SCC25 cells.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [2]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Transwell assay
Mechanism Description miR-485-5p suppresses breast cancer progression and enhances chemosensitivity through down-regulation of survivin expression.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [2]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Transwell assay
Mechanism Description miR-485-5p suppresses breast cancer progression and enhances chemosensitivity through down-regulation of survivin expression.
References
Ref 1 hsa-miR-485-5p reverses epithelial to mesenchymal transition and promotes cisplatin-induced cell death by targeting PAK1 in oral tongue squamous cell carcinoma. Int J Mol Med. 2017 Jul;40(1):83-89. doi: 10.3892/ijmm.2017.2992. Epub 2017 May 16.
Ref 2 miR-485-5p suppresses breast cancer progression and chemosensitivity by targeting survivin. Biochem Biophys Res Commun. 2018 Jun 18;501(1):48-54. doi: 10.1016/j.bbrc.2018.04.129. Epub 2018 Apr 22.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.