Molecule Information
General Information of the Molecule (ID: Mol01655)
| Name |
hsa-miR-485-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 485
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
AGAGGCUGGCCGUGAUGAAUUC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Tongue squamous cell carcinoma [ICD-11: 2B62.1] | [1] | |||
| Sensitive Disease | Tongue squamous cell carcinoma [ICD-11: 2B62.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | SCC25 cells | Oral | Homo sapiens (Human) | CVCL_1682 |
| SCC25-res cells | Tongue | Homo sapiens (Human) | CVCL_A5BQ | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; BrdU incorporation assay | |||
| Mechanism Description | Hsa-miR485-5p reverses epithelial to mesenchymal transition and promotes cisplatin-induced cell death by targeting PAk1 in oral tongue squamous cell carcinom. Overexpression of p21 (RAC1) activated kinase 1 (PAk1) induced epithelial to mesenchymal transition (EMT) and significantly promoted the invasion and migration of oral squamous cell carcinoma SCC25 cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| MDA-MB-468 cells | Breast | Homo sapiens (Human) | CVCL_0419 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Transwell assay | |||
| Mechanism Description | miR-485-5p suppresses breast cancer progression and enhances chemosensitivity through down-regulation of survivin expression. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| MDA-MB-468 cells | Breast | Homo sapiens (Human) | CVCL_0419 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Transwell assay | |||
| Mechanism Description | miR-485-5p suppresses breast cancer progression and enhances chemosensitivity through down-regulation of survivin expression. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
