General Information of the Molecule (ID: Mol01653)
Name
hsa-miR-483-3p ,Homo sapiens
Synonyms
microRNA 483
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UCACUCCUCUCCUCCCGUCUU
    Click to Show/Hide
Ensembl ID
ENSG00000207805
HGNC ID
HGNC:32340
Mature Accession
MIMAT0002173
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Gefitinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Gefitinib
Molecule Alteration Demethylation
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
Cell viability Inhibition hsa05200
FAKT/ERK signaling pathway Inhibition hsa04210
In Vitro Model H1975 cells Lung Homo sapiens (Human) CVCL_1511
H292 cells Lung Homo sapiens (Human) CVCL_0455
A549 cells Lung Homo sapiens (Human) CVCL_0023
H1299 cells Lung Homo sapiens (Human) CVCL_0060
HCC827 cells Lung Homo sapiens (Human) CVCL_2063
PC9 cells Lung Homo sapiens (Human) CVCL_B260
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay; EdU incorporation assay; Flow cytometry assay; Transwell assay
Mechanism Description Epigenetic silencing of miR-483-3p promotes acquired gefitinib resistance and EMT in EGFR-mutant NSCLC by targeting integrin beta3.
References
Ref 1 Epigenetic silencing of miR-483-3p promotes acquired gefitinib resistance and EMT in EGFR-mutant NSCLC by targeting integrin Beta3. Oncogene. 2018 Aug;37(31):4300-4312. doi: 10.1038/s41388-018-0276-2. Epub 2018 May 2.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.