Molecule Information

General Information of the Molecule (ID: Mol01653)

• Name: hsa-miR-483-3p ,Homo sapiens
• Synonyms: microRNA 483
• Molecule Type: Mature miRNA
• Sequence: UCACUCCUCUCCUCCCGUCUU
• Ensembl ID: ENSG00000207805
• HGNC ID: HGNC:32340
• Mature Accession: MIMAT0002173

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Non-small cell lung cancer [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Demethylation; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: FAKT/ERK signaling pathway; Inhibition; hsa04210
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: H292 cells; Lung; Homo sapiens (Human); CVCL_0455
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; EdU incorporation assay; Flow cytometry assay; Transwell assay
• Mechanism Description: Epigenetic silencing of miR-483-3p promotes acquired gefitinib resistance and EMT in EGFR-mutant NSCLC by targeting integrin beta3.

References

• Ref 1: Epigenetic silencing of miR-483-3p promotes acquired gefitinib resistance and EMT in EGFR-mutant NSCLC by targeting integrin Beta3. Oncogene. 2018 Aug;37(31):4300-4312. doi: 10.1038/s41388-018-0276-2. Epub 2018 May 2.