Molecule Information
General Information of the Molecule (ID: Mol01653)
Name |
hsa-miR-483-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 483
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UCACUCCUCUCCUCCCGUCUU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [1] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Gefitinib | |||
Molecule Alteration | Demethylation | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
Cell viability | Inhibition | hsa05200 | ||
FAKT/ERK signaling pathway | Inhibition | hsa04210 | ||
In Vitro Model | H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 |
H292 cells | Lung | Homo sapiens (Human) | CVCL_0455 | |
A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
HCC827 cells | Lung | Homo sapiens (Human) | CVCL_2063 | |
PC9 cells | Lung | Homo sapiens (Human) | CVCL_B260 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; EdU incorporation assay; Flow cytometry assay; Transwell assay | |||
Mechanism Description | Epigenetic silencing of miR-483-3p promotes acquired gefitinib resistance and EMT in EGFR-mutant NSCLC by targeting integrin beta3. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.