Molecule Information

General Information of the Molecule (ID: Mol01646)

• Name: hsa-miR-422a ,Homo sapiens
• Synonyms: microRNA 422a
• Molecule Type: Mature miRNA
• Sequence: ACUGGACUUAGGGUCAGAAGGC
• Ensembl ID: ENSG00000199156
• HGNC ID: HGNC:31879
• Mature Accession: MIMAT0001339

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [1]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2 cells; Bone marrow; Homo sapiens (Human); CVCL_0548
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vitro Model: HFOB cells; Bone; Homo sapiens (Human); CVCL_3708
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis of apoptosis; Transwell assay
• Mechanism Description: Overexpression of miR422a inhibits cell proliferation and invasion, and enhances chemosensitivity by directly targeting TGFbeta2 in osteosarcoma cells.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [2]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: miR422a/MEF2D signaling pathway; Regulation; hsa05206
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: BGC823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: GES-1 cells; Gastric; Homo sapiens (Human); CVCL_EQ22
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-422a has an enhancer activity in DOX-mediated chemosensitivity and cell death.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [1]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2 cells; Bone marrow; Homo sapiens (Human); CVCL_0548
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vitro Model: HFOB cells; Bone; Homo sapiens (Human); CVCL_3708
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis of apoptosis; Transwell assay
• Mechanism Description: Overexpression of miR422a inhibits cell proliferation and invasion, and enhances chemosensitivity by directly targeting TGFbeta2 in osteosarcoma cells.

References

• Ref 1: Overexpression of miR-422a inhibits cell proliferation and invasion, and enhances chemosensitivity in osteosarcoma cells. Oncol Rep. 2016 Dec;36(6):3371-3378. doi: 10.3892/or.2016.5182. Epub 2016 Oct 19.
• Ref 2: The Long Noncoding RNA D63785 Regulates Chemotherapy Sensitivity in Human Gastric Cancer by Targeting miR-422a. Mol Ther Nucleic Acids. 2018 Sep 7;12:405-419. doi: 10.1016/j.omtn.2018.05.024. Epub 2018 Jul 5.