Molecule Information
General Information of the Molecule (ID: Mol01646)
Name |
hsa-miR-422a
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 422a
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
ACUGGACUUAGGGUCAGAAGGC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [1] | |||
Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 | |
U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
HFOB cells | Bone | Homo sapiens (Human) | CVCL_3708 | |
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis of apoptosis; Transwell assay | |||
Mechanism Description | Overexpression of miR422a inhibits cell proliferation and invasion, and enhances chemosensitivity by directly targeting TGFbeta2 in osteosarcoma cells. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [2] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
miR422a/MEF2D signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 |
SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
BGC823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 | |
GES-1 cells | Gastric | Homo sapiens (Human) | CVCL_EQ22 | |
NCI-N87 cells | Gastric | Homo sapiens (Human) | CVCL_1603 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | miR-422a has an enhancer activity in DOX-mediated chemosensitivity and cell death. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [1] | |||
Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 | |
U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
HFOB cells | Bone | Homo sapiens (Human) | CVCL_3708 | |
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis of apoptosis; Transwell assay | |||
Mechanism Description | Overexpression of miR422a inhibits cell proliferation and invasion, and enhances chemosensitivity by directly targeting TGFbeta2 in osteosarcoma cells. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.