Molecule Information
General Information of the Molecule (ID: Mol01646)
| Name |
hsa-miR-422a
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 422a
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
ACUGGACUUAGGGUCAGAAGGC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [1] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 | |
| U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
| HFOB cells | Bone | Homo sapiens (Human) | CVCL_3708 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis of apoptosis; Transwell assay | |||
| Mechanism Description | Overexpression of miR422a inhibits cell proliferation and invasion, and enhances chemosensitivity by directly targeting TGFbeta2 in osteosarcoma cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [2] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| miR422a/MEF2D signaling pathway | Regulation | N.A. | ||
| In Vitro Model | MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| BGC823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 | |
| GES-1 cells | Gastric | Homo sapiens (Human) | CVCL_EQ22 | |
| NCI-N87 cells | Gastric | Homo sapiens (Human) | CVCL_1603 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | miR-422a has an enhancer activity in DOX-mediated chemosensitivity and cell death. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [1] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 | |
| U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
| HFOB cells | Bone | Homo sapiens (Human) | CVCL_3708 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis of apoptosis; Transwell assay | |||
| Mechanism Description | Overexpression of miR422a inhibits cell proliferation and invasion, and enhances chemosensitivity by directly targeting TGFbeta2 in osteosarcoma cells. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
