Molecule Information

General Information of the Molecule (ID: Mol01645)

• Name: hsa-miR-196b-5p ,Homo sapiens
• Synonyms: microRNA 196b
• Molecule Type: Mature miRNA
• Sequence: UAGGUAGUUUCCUGUUGUUGGG
• Ensembl ID: ENSG00000283745
• HGNC ID: HGNC:31790
• Mature Accession: MIMAT0001080

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [1]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: JAKT2/STAT3 signaling pathway; Inhibition; hsa04030
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: DLD1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: CaCo2 cells; Colon; Homo sapiens (Human); CVCL_0025
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: RkO cells; Colon; Homo sapiens (Human); CVCL_0504
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• In Vitro Model: SW1116 cells; Colon; Homo sapiens (Human); CVCL_0544
• In Vitro Model: COLO 205 cells; Colon; Homo sapiens (Human); CVCL_0218
• In Vitro Model: COLO 320DM cells; Colon; Homo sapiens (Human); CVCL_0219
• In Vitro Model: CW-2 cells; Colon; Homo sapiens (Human); CVCL_1151
• In Vitro Model: HCT15 cells; Colon; Homo sapiens (Human); CVCL_0292
• In Vitro Model: LS174T cells; Colon; Homo sapiens (Human); CVCL_1384
• In Vitro Model: NCI-H716 cells; Colon; Homo sapiens (Human); CVCL_1581
• In Vitro Model: SW948 cells; Colon; Homo sapiens (Human); CVCL_0632
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Caspase-9 or -3 activity assays; Spheroid formation assay; Flow cytometric analysis; MTT assay
• Mechanism Description: miR196b-5p promotes stemness and chemoresistance of CRC cells to 5-fluorouracil via targeting negative regulators SOCS1 and SOCS3 of STAT3 signaling pathway, giving rise to activation of STAT3 signaling.

References

• Ref 1: Maintenance of cancer stemness by miR-196b-5p contributes to chemoresistance of colorectal cancer cells via activating STAT3 signaling pathway. Oncotarget. 2017 Jul 25;8(30):49807-49823. doi: 10.18632/oncotarget.17971.