General Information of the Molecule (ID: Mol01645)
Name
hsa-miR-196b-5p ,Homo sapiens
Synonyms
microRNA 196b
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UAGGUAGUUUCCUGUUGUUGGG
    Click to Show/Hide
Ensembl ID
ENSG00000283745
HGNC ID
HGNC:31790
Mature Accession
MIMAT0001080
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation JAKT2/STAT3 signaling pathway Inhibition hsa04030
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
DLD1 cells Colon Homo sapiens (Human) CVCL_0248
SW620 cells Colon Homo sapiens (Human) CVCL_0547
CaCo2 cells Colon Homo sapiens (Human) CVCL_0025
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LOVO cells Colon Homo sapiens (Human) CVCL_0399
RkO cells Colon Homo sapiens (Human) CVCL_0504
HT-29 cells Colon Homo sapiens (Human) CVCL_0320
SW1116 cells Colon Homo sapiens (Human) CVCL_0544
COLO 205 cells Colon Homo sapiens (Human) CVCL_0218
COLO 320DM cells Colon Homo sapiens (Human) CVCL_0219
CW-2 cells Colon Homo sapiens (Human) CVCL_1151
HCT15 cells Colon Homo sapiens (Human) CVCL_0292
LS174T cells Colon Homo sapiens (Human) CVCL_1384
NCI-H716 cells Colon Homo sapiens (Human) CVCL_1581
SW948 cells Colon Homo sapiens (Human) CVCL_0632
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Caspase-9 or -3 activity assays; Spheroid formation assay; Flow cytometric analysis; MTT assay
Mechanism Description miR196b-5p promotes stemness and chemoresistance of CRC cells to 5-fluorouracil via targeting negative regulators SOCS1 and SOCS3 of STAT3 signaling pathway, giving rise to activation of STAT3 signaling.
References
Ref 1 Maintenance of cancer stemness by miR-196b-5p contributes to chemoresistance of colorectal cancer cells via activating STAT3 signaling pathway. Oncotarget. 2017 Jul 25;8(30):49807-49823. doi: 10.18632/oncotarget.17971.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.