Molecule Information
General Information of the Molecule (ID: Mol01645)
Name |
hsa-miR-196b-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 196b
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UAGGUAGUUUCCUGUUGUUGGG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [1] | |||
Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | JAKT2/STAT3 signaling pathway | Inhibition | hsa04030 | |
In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
DLD1 cells | Colon | Homo sapiens (Human) | CVCL_0248 | |
SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
CaCo2 cells | Colon | Homo sapiens (Human) | CVCL_0025 | |
HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
RkO cells | Colon | Homo sapiens (Human) | CVCL_0504 | |
HT-29 cells | Colon | Homo sapiens (Human) | CVCL_0320 | |
SW1116 cells | Colon | Homo sapiens (Human) | CVCL_0544 | |
COLO 205 cells | Colon | Homo sapiens (Human) | CVCL_0218 | |
COLO 320DM cells | Colon | Homo sapiens (Human) | CVCL_0219 | |
CW-2 cells | Colon | Homo sapiens (Human) | CVCL_1151 | |
HCT15 cells | Colon | Homo sapiens (Human) | CVCL_0292 | |
LS174T cells | Colon | Homo sapiens (Human) | CVCL_1384 | |
NCI-H716 cells | Colon | Homo sapiens (Human) | CVCL_1581 | |
SW948 cells | Colon | Homo sapiens (Human) | CVCL_0632 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Caspase-9 or -3 activity assays; Spheroid formation assay; Flow cytometric analysis; MTT assay | |||
Mechanism Description | miR196b-5p promotes stemness and chemoresistance of CRC cells to 5-fluorouracil via targeting negative regulators SOCS1 and SOCS3 of STAT3 signaling pathway, giving rise to activation of STAT3 signaling. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.