Molecule Information

General Information of the Molecule (ID: Mol01644)

• Name: hsa-miR-346 ,Homo sapiens
• Synonyms: microRNA 346
• Molecule Type: Mature miRNA
• Sequence: UGUCUGCCCGCAUGCCUGCCUCU
• Ensembl ID: ENSG00000199104
• HGNC ID: HGNC:31780
• Mature Accession: MIMAT0000773

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Docetaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: HBL-100 cells; Breast; Homo sapiens (Human); CVCL_4362
• In Vitro Model: MCF-7/Doc cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR346 promotes the biological function of breast cancer cells by targeting SRCIN1 and reduces chemosensitivity to docetaxel. Overexpression of miR346 promoted cell proliferation, colony formation, migration and invasion, and reduced apoptosis, sensitivity to Docetaxel.

Paclitaxel

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [3]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: H1993 cells; Lymph node; Homo sapiens (Human); CVCL_1512
• In Vitro Model: H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• Experiment for Molecule Alteration: qRT-PCR; Western blot
• Experiment for Drug Resistance: Cell viability assay; Colony formation assay; Cell cycle analysis; Cell apoptosis and growth rate assays
• Mechanism Description: We demonstrated that two of the miRNA inhibitors (miR-133a/b and miR-361-3p) decrease cell survival by activating caspase-3/7-dependent apoptotic pathways and inducing cell cycle arrest in S phase.We demonstrated that two of the miRNA inhibitors (miR-133a/b and miR-361-3p) decrease cell survival by activating caspase-3/7-dependent apoptotic pathways and inducing cell cycle arrest in S phase.The mimic of miR-346, however, does not rescue the cytotoxic effect of the miR-346 inhibitor, suggesting that the cytotoxicity of the miR-346 inhibitor is most likely to be caused by off-target effects of the synthetic oligo rather than knocking down the expression of the endogenous miR-346.

References

• Ref 1: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 2: MiR-346 promotes the biological function of breast cancer cells by targeting SRCIN1 and reduces chemosensitivity to docetaxel. Gene. 2017 Feb 5;600:21-28. doi: 10.1016/j.gene.2016.11.037. Epub 2016 Nov 29.
• Ref 3: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.