General Information of the Molecule (ID: Mol01644)
Name
hsa-miR-346 ,Homo sapiens
Synonyms
microRNA 346
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGUCUGCCCGCAUGCCUGCCUCU
    Click to Show/Hide
Ensembl ID
ENSG00000199104
HGNC ID
HGNC:31780
Mature Accession
MIMAT0000773
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Docetaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [1]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
HBL-100 cells Breast Homo sapiens (Human) CVCL_4362
MCF-7/Doc cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR346 promotes the biological function of breast cancer cells by targeting SRCIN1 and reduces chemosensitivity to docetaxel. Overexpression of miR346 promoted cell proliferation, colony formation, migration and invasion, and reduced apoptosis, sensitivity to Docetaxel.
References
Ref 1 MiR-346 promotes the biological function of breast cancer cells by targeting SRCIN1 and reduces chemosensitivity to docetaxel. Gene. 2017 Feb 5;600:21-28. doi: 10.1016/j.gene.2016.11.037. Epub 2016 Nov 29.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.