Molecule Information

General Information of the Molecule (ID: Mol01643)

• Name: hsa-miR-133b ,Homo sapiens
• Synonyms: microRNA 133b
• Molecule Type: Mature miRNA
• Sequence: UUUGGUCCCCUUCAACCAGCUA
• Ensembl ID: ENSG00000199080
• HGNC ID: HGNC:31759
• Mature Accession: MIMAT0000770

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [1], [2]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A549/DPP cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299/DDP cells; Lung; Homo sapiens (Human); CVCL_0060
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR133b reduces cisplatin resistance and its overexpression contributes to the suppression of the malignant growth and aggressiveness of cisplatin-resistant NSCLC cells by targeting GSTP1.

Disease Class: Ovarian cancer [3]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR-133b increases ovarian cancer cell sensitivity to cisplatin and paclitaxel by decreasing GST-Pi and MDR1 expression.

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [4]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: EGFR signaling pathway; Inhibition; hsa01521
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: NCI-H1650 cells; Lung; Homo sapiens (Human); CVCL_1483
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-133b suppresses the expression of EGFR, miR-133b transfection may modulate apoptosis, invasion and sensitivity to EGFR-TkI through the EGFR signaling pathways.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [3]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR-133b increases ovarian cancer cell sensitivity to cisplatin and paclitaxel by decreasing GST-Pi and MDR1 expression.

References

• Ref 1: [MiR-133b Affect the Proliferation and Drug Sensitivity in A549 Lung Cancer Stem Cells by Targeting PKM2]. Zhongguo Fei Ai Za Zhi. 2017 Jun 20;20(6):376-381. doi: 10.3779/j.issn.1009-3419.2017.06.02.
• Ref 2: miR-133b reverses cisplatin resistance by targeting GSTP1 in cisplatin-resistant lung cancer cells. Int J Mol Med. 2018 Apr;41(4):2050-2058. doi: 10.3892/ijmm.2018.3382. Epub 2018 Jan 11.
• Ref 3: MicroRNA-133b targets glutathione S-transferase Pi expression to increase ovarian cancer cell sensitivity to chemotherapy drugs. Drug Des Devel Ther. 2015 Sep 16;9:5225-35. doi: 10.2147/DDDT.S87526. eCollection 2015.
• Ref 4: MicroRNA-133b inhibits the growth of non-small-cell lung cancer by targeting the epidermal growth factor receptor. FEBS J. 2012 Oct;279(20):3800-12. doi: 10.1111/j.1742-4658.2012.08741.x. Epub 2012 Sep 11.