Molecule Information
General Information of the Molecule (ID: Mol01643)
Name |
hsa-miR-133b
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 133b
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UUUGGUCCCCUUCAACCAGCUA
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung cancer | [1], [2] | |||
Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell colony | Inhibition | hsa05200 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | A549/DPP cells | Lung | Homo sapiens (Human) | CVCL_0023 |
H1299/DDP cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | miR133b reduces cisplatin resistance and its overexpression contributes to the suppression of the malignant growth and aggressiveness of cisplatin-resistant NSCLC cells by targeting GSTP1. | |||
Disease Class: Ovarian cancer | [3] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Overexpression of miR-133b increases ovarian cancer cell sensitivity to cisplatin and paclitaxel by decreasing GST-Pi and MDR1 expression. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [4] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Gefitinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell migration | Inhibition | hsa04670 | ||
EGFR signaling pathway | Inhibition | hsa01521 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
NCI-H1650 cells | Lung | Homo sapiens (Human) | CVCL_1483 | |
PC9 cells | Lung | Homo sapiens (Human) | CVCL_B260 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-133b suppresses the expression of EGFR, miR-133b transfection may modulate apoptosis, invasion and sensitivity to EGFR-TkI through the EGFR signaling pathways. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [3] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Overexpression of miR-133b increases ovarian cancer cell sensitivity to cisplatin and paclitaxel by decreasing GST-Pi and MDR1 expression. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.