Molecule Information
General Information of the Molecule (ID: Mol01643)
| Name |
hsa-miR-133b
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 133b
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UUUGGUCCCCUUCAACCAGCUA
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [1], [2] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell colony | Inhibition | hsa05200 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | A549/DPP cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| H1299/DDP cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | miR133b reduces cisplatin resistance and its overexpression contributes to the suppression of the malignant growth and aggressiveness of cisplatin-resistant NSCLC cells by targeting GSTP1. | |||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [3] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Overexpression of miR-133b increases ovarian cancer cell sensitivity to cisplatin and paclitaxel by decreasing GST-Pi and MDR1 expression. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [4] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Gefitinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Inhibition | hsa04670 | ||
| EGFR signaling pathway | Inhibition | hsa01521 | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| NCI-H1650 cells | Lung | Homo sapiens (Human) | CVCL_1483 | |
| PC9 cells | Lung | Homo sapiens (Human) | CVCL_B260 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-133b suppresses the expression of EGFR, miR-133b transfection may modulate apoptosis, invasion and sensitivity to EGFR-TkI through the EGFR signaling pathways. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [3] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Overexpression of miR-133b increases ovarian cancer cell sensitivity to cisplatin and paclitaxel by decreasing GST-Pi and MDR1 expression. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
