Molecule Information
General Information of the Molecule (ID: Mol01641)
Name |
hsa-miR-338-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 338
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UCCAGCAUCAGUGAUUUUGUUG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colon cancer | [1] | |||
Sensitive Disease | Colon cancer [ICD-11: 2B90.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | miR338-3p/mTOR signaling pathway | Activation | hsa05206 | |
In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis | |||
Mechanism Description | miR338-3p increased 5-FU resistance by reducing the expression of its target gene, mTOR; and miR338-3p inhibitor sensitized HT29 (mutant p53) and HCT116 p53-/- (deficient p53) cells by activating mTOR; and miR338-3p-mTOR-autophagy was in the competition with 5-FU-induced apoptosis and contributed to the subsequent 5-FU resistance. (Inhibition of mTOR induces autophagy and depresses apoptosis to confer resistance to 5-FU). |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular cancer | [2] | |||
Sensitive Disease | Hepatocellular cancer [ICD-11: 2C12.4] | |||
Sensitive Drug | Sorafenib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
HIF signaling signaling pathway | Inhibition | hsa04066 | ||
In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
BEL-7402 cells | Liver | Homo sapiens (Human) | CVCL_5492 | |
HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
SMMC7721 cells | Uterus | Homo sapiens (Human) | CVCL_0534 | |
L02 cells | Liver | Homo sapiens (Human) | CVCL_6926 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | Overexpression of miR-338-3p inhibited HIF-1alpha 3'-UTR luciferase activity and HIF-1alpha protein levels in HepG2, SMMC-7721, and Huh7 cells. miR-338-3p significantly reduced cell viability and induced cell apoptosis of HCC cells. Additionally, HIF-1alpha overexpression rescued and HIF-1alpha knock-down abrogated the anti-HCC activity of miR-338-3p. Furthermore, miR-338-3p sensitized HCC cells to sorafenib in vitro and in a HCC subcutaneous nude mice tumor model by inhibiting HIF-1alpha. Collectively, miR-338-3p inhibits HCC tumor growth and sensitizes HCC cells to sorafenib by down-regulating HIF-1alpha. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.