Molecule Information

General Information of the Molecule (ID: Mol01641)

• Name: hsa-miR-338-3p ,Homo sapiens
• Synonyms: microRNA 338
• Molecule Type: Mature miRNA
• Sequence: UCCAGCAUCAGUGAUUUUGUUG
• Ensembl ID: ENSG00000283604
• HGNC ID: HGNC:31775
• Mature Accession: MIMAT0000763

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BT-20 cells; Mammary gland; Homo sapiens (Human); CVCL_0178
• In Vitro Model: BT-474 cells; Breast; Homo sapiens (Human); CVCL_0179
• In Vitro Model: BT-549 cells; Breast; Homo sapiens (Human); CVCL_1092
• In Vitro Model: CAMA-1 cells; Breast; Homo sapiens (Human); CVCL_1115
• In Vitro Model: HCC1143 cells; Breast; Homo sapiens (Human); CVCL_1245
• In Vitro Model: HCC1806 cells; Breast; Homo sapiens (Human); CVCL_1258
• In Vitro Model: HCC1937 cells; Breast; Homo sapiens (Human); CVCL_0290
• In Vitro Model: HCC1954 cells; Breast; Homo sapiens (Human); CVCL_1259
• In Vitro Model: HCC38 cells; Breast; Homo sapiens (Human); CVCL_1267
• In Vitro Model: HCC70 cells; Breast; Homo sapiens (Human); CVCL_1270
• In Vitro Model: Hs578T cells; Breast; Homo sapiens (Human); CVCL_0332
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-361 cells; Breast; Homo sapiens (Human); CVCL_0620
• In Vitro Model: MDA-MB-436 cells; Breast; Homo sapiens (Human); CVCL_0623
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vitro Model: SK-BR-3 cells; Pleural effusion; Homo sapiens (Human); CVCL_0033
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: EVSA-T cells; Ascites; Homo sapiens (Human); CVCL_1207
• In Vitro Model: Sk-BR-7 cells; Breast; Homo sapiens (Human); CVCL_5218
• In Vitro Model: SUM159PT cells; Breast; Homo sapiens (Human); CVCL_5423/CVCL_5590
• In Vitro Model: SUM44PE cells; Breast; Homo sapiens (Human); CVCL_3424
• In Vitro Model: SUM52PE cells; Breast; Homo sapiens (Human); CVCL_3425
• Experiment for Molecule Alteration: Microarray analyses
• Mechanism Description: This gene is up-regulated in docetaxel-resistance cells

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [2]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: miR338-3p/mTOR signaling pathway; Activation; hsa05206
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: miR338-3p increased 5-FU resistance by reducing the expression of its target gene, mTOR; and miR338-3p inhibitor sensitized HT29 (mutant p53) and HCT116 p53-/- (deficient p53) cells by activating mTOR; and miR338-3p-mTOR-autophagy was in the competition with 5-FU-induced apoptosis and contributed to the subsequent 5-FU resistance. (Inhibition of mTOR induces autophagy and depresses apoptosis to confer resistance to 5-FU).

Sorafenib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular cancer [ICD-11: 2C12.4] [3]

• Sensitive Disease: Hepatocellular cancer [ICD-11: 2C12.4]
• Sensitive Drug: Sorafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: HIF signaling signaling pathway; Inhibition; hsa04066
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: SMMC7721 cells; Uterus; Homo sapiens (Human); CVCL_0534
• In Vitro Model: L02 cells; Liver; Homo sapiens (Human); CVCL_6926
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Overexpression of miR-338-3p inhibited HIF-1alpha 3'-UTR luciferase activity and HIF-1alpha protein levels in HepG2, SMMC-7721, and Huh7 cells. miR-338-3p significantly reduced cell viability and induced cell apoptosis of HCC cells. Additionally, HIF-1alpha overexpression rescued and HIF-1alpha knock-down abrogated the anti-HCC activity of miR-338-3p. Furthermore, miR-338-3p sensitized HCC cells to sorafenib in vitro and in a HCC subcutaneous nude mice tumor model by inhibiting HIF-1alpha. Collectively, miR-338-3p inhibits HCC tumor growth and sensitizes HCC cells to sorafenib by down-regulating HIF-1alpha.

Clinical Trial Drug(s) 1 drug(s) in total

Hydroxycamptothecin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [4]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Hydroxycamptothecin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• Experiment for Molecule Alteration: MiRNA microarray profiling, qRT-PCR
• Experiment for Drug Resistance: A sulforhodamine B (SRB) assay
• Mechanism Description: MiR-196a, -365, -424, -98, -338, and -224 were markedly upregulated in the resistant cells, but not in the sensitive cells, while miR-99b, -141, -200a, -200b, -372, and -373 were markedly downregulated. The combined analysis revealed 78 relation pairs between the miRNAs and mRNAs.

References

• Ref 1: Alterations in p53 predict response to preoperative high dose chemotherapy in patients with gastric cancerMol Pathol. 2003 Oct;56(5):286-92. doi: 10.1136/mp.56.5.286.
• Ref 2: miR-338-3p confers 5-fluorouracil resistance in p53 mutant colon cancer cells by targeting the mammalian target of rapamycin. Exp Cell Res. 2017 Nov 15;360(2):328-336. doi: 10.1016/j.yexcr.2017.09.023. Epub 2017 Sep 18.
• Ref 3: MiR-338-3p inhibits hepatocarcinoma cells and sensitizes these cells to sorafenib by targeting hypoxia-induced factor 1Alpha. PLoS One. 2014 Dec 22;9(12):e115565. doi: 10.1371/journal.pone.0115565. eCollection 2014.
• Ref 4: MicroRNA-141 confers resistance to cisplatin-induced apoptosis by targeting YAP1 in human esophageal squamous cell carcinoma. J Hum Genet. 2011 Apr;56(4):270-6. doi: 10.1038/jhg.2011.1. Epub 2011 Feb 3.