Molecule Information

General Information of the Molecule (ID: Mol01639)

Name	hsa-miR-135b-5p ,Homo sapiens
Synonyms	microRNA 135b Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	UAUGGCUUUUCAUUCCUAUGUGA Click to Show/Hide
Ensembl ID	ENSG00000199059
HGNC ID	HGNC:31760
Mature Accession	MIMAT0000758
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Gastric cancer				[1]
Resistant Disease	Gastric cancer [ICD-11: 2B72.1]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell viability		Activation	hsa05200
	NF-kappaB signaling pathway		Activation	hsa04064
In Vitro Model	MkN-45 cells	Gastric	Homo sapiens (Human)	CVCL_0434
	SNU1 cells	Gastric	Homo sapiens (Human)	CVCL_0099
	SNU601 cells	Gastric	Homo sapiens (Human)	CVCL_0101
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	ATP-Glo cell viability assay
Mechanism Description	miR-135b-5p protects gastric cancer cells from cisplatin-induced apoptosis and miR-135b-5p overexpression or kLF4 down-regulation lead to cisplatin resistance in gastric cancer cells.

Doxorubicin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer				[2]
Sensitive Disease	Breast cancer [ICD-11: 2C60.3]			Disease Info
Sensitive Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell viability		Inhibition	hsa05200
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	MDA-MB-231 cells	Breast	Homo sapiens (Human)	CVCL_0062
In Vivo Model	BALB/c nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qPCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	miR-135b-5p enhances doxorubicin-sensitivity of breast cancer cells through targeting anterior gradient 2.

References

Ref 1	Helicobacter pylori-induced miR-135b-5p promotes cisplatin resistance in gastric cancer. FASEB J. 2019 Jan;33(1):264-274. doi: 10.1096/fj.201701456RR. Epub 2018 Jul 9.
Ref 2	miR-135b-5p enhances doxorubicin-sensitivity of breast cancer cells through targeting anterior gradient 2. J Exp Clin Cancer Res. 2019 Jan 21;38(1):26. doi: 10.1186/s13046-019-1024-3.