General Information of the Molecule (ID: Mol01639)
Name
hsa-miR-135b-5p ,Homo sapiens
Synonyms
microRNA 135b
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UAUGGCUUUUCAUUCCUAUGUGA
    Click to Show/Hide
Ensembl ID
ENSG00000199059
HGNC ID
HGNC:31760
Mature Accession
MIMAT0000758
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Activation hsa05200
NF-kappaB signaling pathway Activation hsa04064
In Vitro Model MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
SNU1 cells Gastric Homo sapiens (Human) CVCL_0099
SNU601 cells Gastric Homo sapiens (Human) CVCL_0101
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
ATP-Glo cell viability assay
Mechanism Description miR-135b-5p protects gastric cancer cells from cisplatin-induced apoptosis and miR-135b-5p overexpression or kLF4 down-regulation lead to cisplatin resistance in gastric cancer cells.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [2]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-135b-5p enhances doxorubicin-sensitivity of breast cancer cells through targeting anterior gradient 2.
References
Ref 1 Helicobacter pylori-induced miR-135b-5p promotes cisplatin resistance in gastric cancer. FASEB J. 2019 Jan;33(1):264-274. doi: 10.1096/fj.201701456RR. Epub 2018 Jul 9.
Ref 2 miR-135b-5p enhances doxorubicin-sensitivity of breast cancer cells through targeting anterior gradient 2. J Exp Clin Cancer Res. 2019 Jan 21;38(1):26. doi: 10.1186/s13046-019-1024-3.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.