Molecule Information
General Information of the Molecule (ID: Mol01639)
| Name |
hsa-miR-135b-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 135b
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UAUGGCUUUUCAUUCCUAUGUGA
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
| NF-kappaB signaling pathway | Activation | hsa04064 | ||
| In Vitro Model | MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 |
| SNU1 cells | Gastric | Homo sapiens (Human) | CVCL_0099 | |
| SNU601 cells | Gastric | Homo sapiens (Human) | CVCL_0101 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
ATP-Glo cell viability assay | |||
| Mechanism Description | miR-135b-5p protects gastric cancer cells from cisplatin-induced apoptosis and miR-135b-5p overexpression or kLF4 down-regulation lead to cisplatin resistance in gastric cancer cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell viability | Inhibition | hsa05200 | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-135b-5p enhances doxorubicin-sensitivity of breast cancer cells through targeting anterior gradient 2. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
