General Information of the Molecule (ID: Mol01636)
Name
hsa-miR-337-3p ,Homo sapiens
Synonyms
microRNA 337
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CUCCUAUAUGAUGCCUUUCUUC
    Click to Show/Hide
Ensembl ID
ENSG00000199151
HGNC ID
HGNC:31774
Mature Accession
MIMAT0000754
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model NCI-H1155 cells Lung Homo sapiens (Human) CVCL_1456
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description Over-expression of miR-337-3p nor the specific knockdown of STAT3 and RAP1A significantly decrease cell viability or induce G2/M arrest alone, but rather enhance G2/M arrest and cell death only under conditions of paclitaxel treatment.
Taxane
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Taxane
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model NCI-H1155 cells Lung Homo sapiens (Human) CVCL_1456
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description Over-expression of miR-337-3p nor the specific knockdown of STAT3 and RAP1A significantly decrease cell viability or induce G2/M arrest alone, but rather enhance G2/M arrest and cell death only under conditions of paclitaxel treatment.
References
Ref 1 miR-337-3p and its targets STAT3 and RAP1A modulate taxane sensitivity in non-small cell lung cancers. PLoS One. 2012;7(6):e39167. doi: 10.1371/journal.pone.0039167. Epub 2012 Jun 18.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.