Molecule Information

General Information of the Molecule (ID: Mol01636)

Name	hsa-miR-337-3p ,Homo sapiens
Synonyms	microRNA 337 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	CUCCUAUAUGAUGCCUUUCUUC Click to Show/Hide
Ensembl ID	ENSG00000199151
HGNC ID	HGNC:31774
Mature Accession	MIMAT0000754
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

6 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0]				[1]
Resistant Disease	Osteosarcoma [ICD-11: 2B51.0]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	The most upregulated circRNA, miRNA, and mRNA were hsa_circ_0004674 (17-fold change), hsa-miR-337-3p (12-fold change), and C6orf106 (124-fold change), respectively. The most downregulated circRNA, miRNA, and mRNA were hsa_circ_0068458 (12-fold change), hsa-miR-203a-3p (10-fold change), and AKR1C2 (197-fold change), respectively.

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0]				[1]
Resistant Disease	Osteosarcoma [ICD-11: 2B51.0]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	The most upregulated circRNA, miRNA, and mRNA were hsa_circ_0004674 (17-fold change), hsa-miR-337-3p (12-fold change), and C6orf106 (124-fold change), respectively. The most downregulated circRNA, miRNA, and mRNA were hsa_circ_0068458 (12-fold change), hsa-miR-203a-3p (10-fold change), and AKR1C2 (197-fold change), respectively.

Ifosfamide

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0]				[1]
Resistant Disease	Osteosarcoma [ICD-11: 2B51.0]			Disease Info
Resistant Drug	Ifosfamide			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	The most upregulated circRNA, miRNA, and mRNA were hsa_circ_0004674 (17-fold change), hsa-miR-337-3p (12-fold change), and C6orf106 (124-fold change), respectively. The most downregulated circRNA, miRNA, and mRNA were hsa_circ_0068458 (12-fold change), hsa-miR-203a-3p (10-fold change), and AKR1C2 (197-fold change), respectively.

Methotrexate

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0]				[1]
Resistant Disease	Osteosarcoma [ICD-11: 2B51.0]			Disease Info
Resistant Drug	Methotrexate			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	The most upregulated circRNA, miRNA, and mRNA were hsa_circ_0004674 (17-fold change), hsa-miR-337-3p (12-fold change), and C6orf106 (124-fold change), respectively. The most downregulated circRNA, miRNA, and mRNA were hsa_circ_0068458 (12-fold change), hsa-miR-203a-3p (10-fold change), and AKR1C2 (197-fold change), respectively.

Paclitaxel

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y]				[2]
Sensitive Disease	Non-small cell lung cancer [ICD-11: 2C25.Y]			Disease Info
Sensitive Drug	Paclitaxel			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	NCI-H1155 cells	Lung	Homo sapiens (Human)	CVCL_1456
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTS assay
Mechanism Description	Over-expression of miR-337-3p nor the specific knockdown of STAT3 and RAP1A significantly decrease cell viability or induce G2/M arrest alone, but rather enhance G2/M arrest and cell death only under conditions of paclitaxel treatment.

Taxane

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y]				[2]
Sensitive Disease	Non-small cell lung cancer [ICD-11: 2C25.Y]			Disease Info
Sensitive Drug	Taxane			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	NCI-H1155 cells	Lung	Homo sapiens (Human)	CVCL_1456
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTS assay
Mechanism Description	Over-expression of miR-337-3p nor the specific knockdown of STAT3 and RAP1A significantly decrease cell viability or induce G2/M arrest alone, but rather enhance G2/M arrest and cell death only under conditions of paclitaxel treatment.

References

Ref 1	Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.
Ref 2	miR-337-3p and its targets STAT3 and RAP1A modulate taxane sensitivity in non-small cell lung cancers. PLoS One. 2012;7(6):e39167. doi: 10.1371/journal.pone.0039167. Epub 2012 Jun 18.