Molecule Information

General Information of the Molecule (ID: Mol01636)

• Name: hsa-miR-337-3p ,Homo sapiens
• Synonyms: microRNA 337
• Molecule Type: Mature miRNA
• Sequence: CUCCUAUAUGAUGCCUUUCUUC
• Ensembl ID: ENSG00000199151
• HGNC ID: HGNC:31774
• Mature Accession: MIMAT0000754

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: NCI-H1155 cells; Lung; Homo sapiens (Human); CVCL_1456
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Over-expression of miR-337-3p nor the specific knockdown of STAT3 and RAP1A significantly decrease cell viability or induce G2/M arrest alone, but rather enhance G2/M arrest and cell death only under conditions of paclitaxel treatment.

Taxane

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Taxane
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: NCI-H1155 cells; Lung; Homo sapiens (Human); CVCL_1456
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Over-expression of miR-337-3p nor the specific knockdown of STAT3 and RAP1A significantly decrease cell viability or induce G2/M arrest alone, but rather enhance G2/M arrest and cell death only under conditions of paclitaxel treatment.

References

• Ref 1: miR-337-3p and its targets STAT3 and RAP1A modulate taxane sensitivity in non-small cell lung cancers. PLoS One. 2012;7(6):e39167. doi: 10.1371/journal.pone.0039167. Epub 2012 Jun 18.