Molecule Information

General Information of the Molecule (ID: Mol01631)

• Name: hsa-miR-373-3p ,Homo sapiens
• Synonyms: microRNA 373
• Molecule Type: Mature miRNA
• Sequence: GAAGUGCUUCGAUUUUGGGGUGU
• Ensembl ID: ENSG00000199143
• HGNC ID: HGNC:31787
• Mature Accession: MIMAT0000726

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic carcinoma [1]

• Sensitive Disease: Pancreatic carcinoma [ICD-11: 2C10.2]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-373-3p enhances the chemosensitivity of gemcitabine through cell cycle pathway by downregulating CCND2 in pancreatic carcinoma cells.

References

• Ref 1: MiR-373-3p enhances the chemosensitivity of gemcitabine through cell cycle pathway by targeting CCND2 in pancreatic carcinoma cells. Biomed Pharmacother. 2018 Sep;105:887-898. doi: 10.1016/j.biopha.2018.05.091. Epub 2018 Jun 19.