General Information of the Molecule (ID: Mol01627)
Name
hsa-miR-365a-3p ,Homo sapiens
Synonyms
microRNA 365a
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UAAUGCCCCUAAAAAUCCUUAU
    Click to Show/Hide
Ensembl ID
ENSG00000199130
HGNC ID
HGNC:33692
Mature Accession
MIMAT0000710
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Oral squamous cell carcinoma [ICD-11: 2B6E.0] [1]
Sensitive Disease Oral squamous cell carcinoma [ICD-11: 2B6E.0]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Beta5-integrin/c-Met signaling pathway Inhibition hsa01521
Cell viability Activation hsa05200
In Vitro Model C9-IV3 cells Oral Homo sapiens (Human) N.A.
CGHNC9 cells Oral Homo sapiens (Human) N.A.
OC-3 cells Oral Homo sapiens (Human) CVCL_WL09
In Vivo Model CB17-SCID mice xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR-365-3p targets EHF to inhibit OSCC migration, invasion, and metastasis through kRT16.
References
Ref 1 A novel miR-365-3p/EHF/keratin 16 axis promotes oral squamous cell carcinoma metastasis, cancer stemness and drug resistance via enhancing Beta5-integrin/c-met signaling pathway. J Exp Clin Cancer Res. 2019 Feb 19;38(1):89. doi: 10.1186/s13046-019-1091-5.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.