Molecule Information
General Information of the Molecule (ID: Mol01627)
Name |
hsa-miR-365a-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 365a
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UAAUGCCCCUAAAAAUCCUUAU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Oral squamous cell carcinoma | [1] | |||
Sensitive Disease | Oral squamous cell carcinoma [ICD-11: 2B6E.0] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Beta5-integrin/c-Met signaling pathway | Inhibition | hsa01521 | |
Cell viability | Activation | hsa05200 | ||
In Vitro Model | C9-IV3 cells | Oral | Homo sapiens (Human) | N.A. |
CGHNC9 cells | Oral | Homo sapiens (Human) | N.A. | |
OC-3 cells | Oral | Homo sapiens (Human) | CVCL_WL09 | |
In Vivo Model | CB17-SCID mice xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | miR-365-3p targets EHF to inhibit OSCC migration, invasion, and metastasis through kRT16. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.