Molecule Information
General Information of the Molecule (ID: Mol01627)
| Name |
hsa-miR-365a-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 365a
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UAAUGCCCCUAAAAAUCCUUAU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Oral squamous cell carcinoma [ICD-11: 2B6E.0] | [1] | |||
| Sensitive Disease | Oral squamous cell carcinoma [ICD-11: 2B6E.0] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Beta5-integrin/c-Met signaling pathway | Inhibition | hsa01521 | |
| Cell viability | Activation | hsa05200 | ||
| In Vitro Model | C9-IV3 cells | Oral | Homo sapiens (Human) | N.A. |
| CGHNC9 cells | Oral | Homo sapiens (Human) | N.A. | |
| OC-3 cells | Oral | Homo sapiens (Human) | CVCL_WL09 | |
| In Vivo Model | CB17-SCID mice xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | miR-365-3p targets EHF to inhibit OSCC migration, invasion, and metastasis through kRT16. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
