Molecule Information

General Information of the Molecule (ID: Mol01627)

• Name: hsa-miR-365a-3p ,Homo sapiens
• Synonyms: microRNA 365a
• Molecule Type: Mature miRNA
• Sequence: UAAUGCCCCUAAAAAUCCUUAU
• Ensembl ID: ENSG00000199130
• HGNC ID: HGNC:33692
• Mature Accession: MIMAT0000710

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Oral squamous cell carcinoma [1]

• Sensitive Disease: Oral squamous cell carcinoma [ICD-11: 2B6E.0]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Beta5-integrin/c-Met signaling pathway; Inhibition; hsa01521
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: C9-IV3 cells; Oral; Homo sapiens (Human); N.A.
• In Vitro Model: CGHNC9 cells; Oral; Homo sapiens (Human); N.A.
• In Vitro Model: OC-3 cells; Oral; Homo sapiens (Human); CVCL_WL09
• In Vivo Model: CB17-SCID mice xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-365-3p targets EHF to inhibit OSCC migration, invasion, and metastasis through kRT16.

References

• Ref 1: A novel miR-365-3p/EHF/keratin 16 axis promotes oral squamous cell carcinoma metastasis, cancer stemness and drug resistance via enhancing Beta5-integrin/c-met signaling pathway. J Exp Clin Cancer Res. 2019 Feb 19;38(1):89. doi: 10.1186/s13046-019-1091-5.