General Information of the Molecule (ID: Mol01626)
Name
hsa-miR-299-3p ,Homo sapiens
Synonyms
microRNA 299
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UAUGUGGGAUGGUAAACCGCUU
    Click to Show/Hide
Ensembl ID
ENSG00000207749
HGNC ID
HGNC:31618
Mature Accession
MIMAT0000687
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [ICD-11: 2C25.5] [1]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model NCI-H69 cells Lung Homo sapiens (Human) CVCL_1579
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR-299-3p in doxorubicin-sensitive lung cancer was decreased less than that in doxorubicin-resistant lung cancer samples, which directly regulated the expression of ABCE1. Over-expression of miR-299-3p was significantly inhibited the cell proliferation and increased cell apoptosis in H69/ADR lung cancer cells, and also promoted cell inhibitory rate. Over-expression of miR-299-3p promotes the sensibility of lung cancer to doxorubicin.
References
Ref 1 MicroRNA-299-3p promotes the sensibility of lung cancer to doxorubicin through directly targeting ABCE1. Int J Clin Exp Pathol. 2015 Sep 1;8(9):10072-81. eCollection 2015.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.