Molecule Information

General Information of the Molecule (ID: Mol01626)

• Name: hsa-miR-299-3p ,Homo sapiens
• Synonyms: microRNA 299
• Molecule Type: Mature miRNA
• Sequence: UAUGUGGGAUGGUAAACCGCUU
• Ensembl ID: ENSG00000207749
• HGNC ID: HGNC:31618
• Mature Accession: MIMAT0000687

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [1]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: NCI-H69 cells; Lung; Homo sapiens (Human); CVCL_1579
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-299-3p in doxorubicin-sensitive lung cancer was decreased less than that in doxorubicin-resistant lung cancer samples, which directly regulated the expression of ABCE1. Over-expression of miR-299-3p was significantly inhibited the cell proliferation and increased cell apoptosis in H69/ADR lung cancer cells, and also promoted cell inhibitory rate. Over-expression of miR-299-3p promotes the sensibility of lung cancer to doxorubicin.

References

• Ref 1: MicroRNA-299-3p promotes the sensibility of lung cancer to doxorubicin through directly targeting ABCE1. Int J Clin Exp Pathol. 2015 Sep 1;8(9):10072-81. eCollection 2015.