Molecule Information

General Information of the Molecule (ID: Mol01625)

• Name: hsa-miR-34c-5p ,Homo sapiens
• Synonyms: microRNA 34c
• Molecule Type: Mature miRNA
• Sequence: AGGCAGUGUAGUUAGCUGAUUGC
• Ensembl ID: ENSG00000207562
• HGNC ID: HGNC:31637
• Mature Accession: MIMAT0000686

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Carboplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Carboplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT signaling pathway; Activation; hsa04151
• In Vitro Model: OVS1 cells; Ovary; Homo sapiens (Human); N.A.
• In Vitro Model: SkOV-I6 cells; Ovary; Homo sapiens (Human); N.A.
• In Vivo Model: Mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miRNA-34c-5p inhibits amphiregulin-induced ovarian cancer stemness and drug resistance via downregulation of the AREG-EGFR-ERk pathway.

Docetaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT signaling pathway; Activation; hsa04151
• In Vitro Model: OVS1 cells; Ovary; Homo sapiens (Human); N.A.
• In Vitro Model: SkOV-I6 cells; Ovary; Homo sapiens (Human); N.A.
• In Vivo Model: Mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miRNA-34c-5p inhibits amphiregulin-induced ovarian cancer stemness and drug resistance via downregulation of the AREG-EGFR-ERk pathway.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [2]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Bmf (Bcl-2-modifying factor) is a target of miR-34c-5p, and that its silencing, together with that of c-myc, a known target of miR-34c-5p, contributes to resistance to apoptosis induced by paclitaxel through p53 downregulation.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [3]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: GES-1 cells; Gastric; Homo sapiens (Human); CVCL_EQ22
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MAPT is a microtubule-associated protein which promotes the assembly of tubulin into microtubules to stabilize microtubule structure. Reduced expression of MAPT has been also associated with a better response to paclitaxel in gastric cancer patients, reduced expression of miR-34c-5p, provides a possible mechanism of paclitaxel resistance in gastric cancer, overexpression of miR-34c-5p reduces MAPT expression and restores paclitaxel sensitivity.

Pirarubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [4]

• Sensitive Disease: Cervical cancer [ICD-11: 2C77.0]
• Sensitive Drug: Pirarubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: miR34C-5p/ATG4B-autophagy signaling pathway; Regulation; hsa05206
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• In Vitro Model: C33A cells; Uterus; Homo sapiens (Human); CVCL_1094
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: On the one side, THP induces apoptosis, which results in cell death. On the other side, THP activates the MIR34C-5p-ATG4B-autophagy signaling axis via the sequential triggering of MIR34C-5p downregulation, ATG4B mRNA stability enhancement, and ATG4B upregulation and autophagy induction. Moreover, autophagy protects cervical cancer cells from cell death. The autophagy inhibitor CQ sensitizes cervical cancer cells to THP treatment.

References

• Ref 1: miRNA-34c-5p inhibits amphiregulin-induced ovarian cancer stemness and drug resistance via downregulation of the AREG-EGFR-ERK pathway. Oncogenesis. 2017 May 1;6(5):e326. doi: 10.1038/oncsis.2017.25.
• Ref 2: miR-34c may protect lung cancer cells from paclitaxel-induced apoptosis. Oncogene. 2013 Jan 17;32(3):341-51. doi: 10.1038/onc.2012.51. Epub 2012 Feb 27.
• Ref 3: Regulation of microtubule-associated protein tau (MAPT) by miR-34c-5p determines the chemosensitivity of gastric cancer to paclitaxel. Cancer Chemother Pharmacol. 2013 May;71(5):1159-71. doi: 10.1007/s00280-013-2108-y. Epub 2013 Feb 20.
• Ref 4: Targeting the MIR34C-5p-ATG4B-autophagy axis enhances the sensitivity of cervical cancer cells to pirarubicin. Autophagy. 2016 Jul 2;12(7):1105-17. doi: 10.1080/15548627.2016.1173798. Epub 2016 Apr 20.