General Information of the Molecule (ID: Mol01625)
Name
hsa-miR-34c-5p ,Homo sapiens
Synonyms
microRNA 34c
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AGGCAGUGUAGUUAGCUGAUUGC
    Click to Show/Hide
Ensembl ID
ENSG00000207562
HGNC ID
HGNC:31637
Mature Accession
MIMAT0000686
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Carboplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Carboplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT signaling pathway Activation hsa04151
In Vitro Model OVS1 cells Ovary Homo sapiens (Human) N.A.
SkOV-I6 cells Ovary Homo sapiens (Human) N.A.
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miRNA-34c-5p inhibits amphiregulin-induced ovarian cancer stemness and drug resistance via downregulation of the AREG-EGFR-ERk pathway.
Docetaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT signaling pathway Activation hsa04151
In Vitro Model OVS1 cells Ovary Homo sapiens (Human) N.A.
SkOV-I6 cells Ovary Homo sapiens (Human) N.A.
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miRNA-34c-5p inhibits amphiregulin-induced ovarian cancer stemness and drug resistance via downregulation of the AREG-EGFR-ERk pathway.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [ICD-11: 2C25.5] [2]
Resistant Disease Lung cancer [ICD-11: 2C25.5]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Bmf (Bcl-2-modifying factor) is a target of miR-34c-5p, and that its silencing, together with that of c-myc, a known target of miR-34c-5p, contributes to resistance to apoptosis induced by paclitaxel through p53 downregulation.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
GES-1 cells Gastric Homo sapiens (Human) CVCL_EQ22
MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description MAPT is a microtubule-associated protein which promotes the assembly of tubulin into microtubules to stabilize microtubule structure. Reduced expression of MAPT has been also associated with a better response to paclitaxel in gastric cancer patients, reduced expression of miR-34c-5p, provides a possible mechanism of paclitaxel resistance in gastric cancer, overexpression of miR-34c-5p reduces MAPT expression and restores paclitaxel sensitivity.
Pirarubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Cervical cancer [ICD-11: 2C77.0] [4]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
Sensitive Drug Pirarubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
miR34C-5p/ATG4B-autophagy signaling pathway Regulation N.A.
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Siha cells Cervix uteri Homo sapiens (Human) CVCL_0032
C33A cells Uterus Homo sapiens (Human) CVCL_1094
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description On the one side, THP induces apoptosis, which results in cell death. On the other side, THP activates the MIR34C-5p-ATG4B-autophagy signaling axis via the sequential triggering of MIR34C-5p downregulation, ATG4B mRNA stability enhancement, and ATG4B upregulation and autophagy induction. Moreover, autophagy protects cervical cancer cells from cell death. The autophagy inhibitor CQ sensitizes cervical cancer cells to THP treatment.
References
Ref 1 miRNA-34c-5p inhibits amphiregulin-induced ovarian cancer stemness and drug resistance via downregulation of the AREG-EGFR-ERK pathway. Oncogenesis. 2017 May 1;6(5):e326. doi: 10.1038/oncsis.2017.25.
Ref 2 miR-34c may protect lung cancer cells from paclitaxel-induced apoptosis. Oncogene. 2013 Jan 17;32(3):341-51. doi: 10.1038/onc.2012.51. Epub 2012 Feb 27.
Ref 3 Regulation of microtubule-associated protein tau (MAPT) by miR-34c-5p determines the chemosensitivity of gastric cancer to paclitaxel. Cancer Chemother Pharmacol. 2013 May;71(5):1159-71. doi: 10.1007/s00280-013-2108-y. Epub 2013 Feb 20.
Ref 4 Targeting the MIR34C-5p-ATG4B-autophagy axis enhances the sensitivity of cervical cancer cells to pirarubicin. Autophagy. 2016 Jul 2;12(7):1105-17. doi: 10.1080/15548627.2016.1173798. Epub 2016 Apr 20.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.