Molecule Information
General Information of the Molecule (ID: Mol01625)
Name |
hsa-miR-34c-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 34c
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AGGCAGUGUAGUUAGCUGAUUGC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [1] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Carboplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | AKT signaling pathway | Activation | hsa04151 | |
In Vitro Model | OVS1 cells | Ovary | Homo sapiens (Human) | N.A. |
SkOV-I6 cells | Ovary | Homo sapiens (Human) | N.A. | |
In Vivo Model | Mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miRNA-34c-5p inhibits amphiregulin-induced ovarian cancer stemness and drug resistance via downregulation of the AREG-EGFR-ERk pathway. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [1] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Docetaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | AKT signaling pathway | Activation | hsa04151 | |
In Vitro Model | OVS1 cells | Ovary | Homo sapiens (Human) | N.A. |
SkOV-I6 cells | Ovary | Homo sapiens (Human) | N.A. | |
In Vivo Model | Mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miRNA-34c-5p inhibits amphiregulin-induced ovarian cancer stemness and drug resistance via downregulation of the AREG-EGFR-ERk pathway. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung cancer | [2] | |||
Resistant Disease | Lung cancer [ICD-11: 2C25.5] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Bmf (Bcl-2-modifying factor) is a target of miR-34c-5p, and that its silencing, together with that of c-myc, a known target of miR-34c-5p, contributes to resistance to apoptosis induced by paclitaxel through p53 downregulation. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [3] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
GES-1 cells | Gastric | Homo sapiens (Human) | CVCL_EQ22 | |
MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | MAPT is a microtubule-associated protein which promotes the assembly of tubulin into microtubules to stabilize microtubule structure. Reduced expression of MAPT has been also associated with a better response to paclitaxel in gastric cancer patients, reduced expression of miR-34c-5p, provides a possible mechanism of paclitaxel resistance in gastric cancer, overexpression of miR-34c-5p reduces MAPT expression and restores paclitaxel sensitivity. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Cervical cancer | [4] | |||
Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
Sensitive Drug | Pirarubicin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
miR34C-5p/ATG4B-autophagy signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
Siha cells | Cervix uteri | Homo sapiens (Human) | CVCL_0032 | |
C33A cells | Uterus | Homo sapiens (Human) | CVCL_1094 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | On the one side, THP induces apoptosis, which results in cell death. On the other side, THP activates the MIR34C-5p-ATG4B-autophagy signaling axis via the sequential triggering of MIR34C-5p downregulation, ATG4B mRNA stability enhancement, and ATG4B upregulation and autophagy induction. Moreover, autophagy protects cervical cancer cells from cell death. The autophagy inhibitor CQ sensitizes cervical cancer cells to THP treatment. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.