Molecule Information
General Information of the Molecule (ID: Mol01619)
| Name |
hsa-miR-206
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 206
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UGGAAUGUAAGGAAGUGUGUGG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| Cell viability | Activation | hsa05200 | ||
| MAPK2 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| BGC823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; EdU assay; Flow cytometry assay | |||
| Mechanism Description | BGC823/DDP and SGC7901/DDP cell presented lower miR-206 than parental cells, plus higher MAPk3 mRNA or protein. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] | [2] | |||
| Sensitive Disease | Lung adenocarcinoma [ICD-11: 2C25.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell migration | Inhibition | hsa04670 | ||
| MET/PI3K/AKT/mTOR signaling pathway | Regulation | N.A. | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-206 overexpression in human lung adenocarcinoma cisplatin resistant cells inhibited the EMT and cisplatin resistance by targeting MET and suppressing its downstream PI3k/AkT/mTOR signaling pathway. Low expression of miR-206 and high levels of MET were strongly associated with the poor cisplatin sensitivity of lung adenocarcinoma patients. Therefore, activation of miR-206 or inactivation of its target gene pathway may be a potential strategy to reverse cisplatin resistance in human lung adenocarcinoma cisplatin resistant cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [3] | |||
| Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
| RkO cells | Colon | Homo sapiens (Human) | CVCL_0504 | |
| In Vivo Model | SCID mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTS assay; Flow cytometry assay | |||
| Mechanism Description | miR-206 downregulation modulates 5-FU resistance in HCT116 cells by upregulating Bcl-2. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [4] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | As a potential tumor suppressor, miR206 directly targets CDk4 to suppress the cell growth and enhance the chemotherapy sensitivity to 5-Fu in ovarian cancer cells in vitro. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] | [5] | |||
| Sensitive Disease | Papillary thyroid carcinoma [ICD-11: 2D10.1] | |||
| Sensitive Drug | Levothyroxine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| Cell viability | Inhibition | hsa05200 | ||
| JNk signaling pathway | Inhibition | hsa04010 | ||
| p38 signaling pathway | Inhibition | hsa04010 | ||
| In Vitro Model | TPC-1 cells | Thyroid | Homo sapiens (Human) | CVCL_6298 |
| Nthy-ori3-1 cells | Thyroid | Homo sapiens (Human) | CVCL_2659 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; EdU assay; Flow cytometry assay | |||
| Mechanism Description | Over-expression of miR-206 decreases the Euthyrox-resistance by targeting MAP4k3 in papillary thyroid carcinoma. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
