General Information of the Molecule (ID: Mol01619)
Name
hsa-miR-206 ,Homo sapiens
Synonyms
microRNA 206
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGGAAUGUAAGGAAGUGUGUGG
    Click to Show/Hide
Ensembl ID
ENSG00000207604
HGNC ID
HGNC:31584
Mature Accession
MIMAT0000462
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
Cell viability Activation hsa05200
MAPK2 signaling pathway Regulation N.A.
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
BGC823 cells Gastric Homo sapiens (Human) CVCL_3360
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; EdU assay; Flow cytometry assay
Mechanism Description BGC823/DDP and SGC7901/DDP cell presented lower miR-206 than parental cells, plus higher MAPk3 mRNA or protein.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [2]
Sensitive Disease Lung adenocarcinoma [ICD-11: 2C25.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
MET/PI3K/AKT/mTOR signaling pathway Regulation N.A.
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H1299 cells Lung Homo sapiens (Human) CVCL_0060
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-206 overexpression in human lung adenocarcinoma cisplatin resistant cells inhibited the EMT and cisplatin resistance by targeting MET and suppressing its downstream PI3k/AkT/mTOR signaling pathway. Low expression of miR-206 and high levels of MET were strongly associated with the poor cisplatin sensitivity of lung adenocarcinoma patients. Therefore, activation of miR-206 or inactivation of its target gene pathway may be a potential strategy to reverse cisplatin resistance in human lung adenocarcinoma cisplatin resistant cells.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [3]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
RkO cells Colon Homo sapiens (Human) CVCL_0504
In Vivo Model SCID mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay; Flow cytometry assay
Mechanism Description miR-206 downregulation modulates 5-FU resistance in HCT116 cells by upregulating Bcl-2.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [4]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description As a potential tumor suppressor, miR206 directly targets CDk4 to suppress the cell growth and enhance the chemotherapy sensitivity to 5-Fu in ovarian cancer cells in vitro.
Levothyroxine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] [5]
Sensitive Disease Papillary thyroid carcinoma [ICD-11: 2D10.1]
Sensitive Drug Levothyroxine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
Cell viability Inhibition hsa05200
JNk signaling pathway Inhibition hsa04010
p38 signaling pathway Inhibition hsa04010
In Vitro Model TPC-1 cells Thyroid Homo sapiens (Human) CVCL_6298
Nthy-ori3-1 cells Thyroid Homo sapiens (Human) CVCL_2659
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; EdU assay; Flow cytometry assay
Mechanism Description Over-expression of miR-206 decreases the Euthyrox-resistance by targeting MAP4k3 in papillary thyroid carcinoma.
References
Ref 1 MicroRNA-206 facilitates gastric cancer cell apoptosis and suppresses cisplatin resistance by targeting MAPK2 signaling pathway. Eur Rev Med Pharmacol Sci. 2019 Jan;23(1):171-180. doi: 10.26355/eurrev_201901_16761.
Ref 2 miR-206 regulates cisplatin resistance and EMT in human lung adenocarcinoma cells partly by targeting MET. Oncotarget. 2016 Apr 26;7(17):24510-26. doi: 10.18632/oncotarget.8229.
Ref 3 miR-206 regulates 5-FU resistance by targeting Bcl-2 in colon cancer cells. Onco Targets Ther. 2018 Mar 29;11:1757-1765. doi: 10.2147/OTT.S159093. eCollection 2018.
Ref 4 [Role of miR-206/CDK4 in modulating the growth and chemotlerapy sensitivity of ovarian cancer cells]. Nan Fang Yi Ke Da Xue Xue Bao. 2017 Mar 20;37(3):393-397. doi: 10.3969/j.issn.1673-4254.2017.03.20.
Ref 5 Over-expression of miR-206 decreases the Euthyrox-resistance by targeting MAP4K3 in papillary thyroid carcinoma. Biomed Pharmacother. 2019 Jun;114:108605. doi: 10.1016/j.biopha.2019.108605. Epub 2019 Mar 21.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.