Molecule Information

General Information of the Molecule (ID: Mol01619)

• Name: hsa-miR-206 ,Homo sapiens
• Synonyms: microRNA 206
• Molecule Type: Mature miRNA
• Sequence: UGGAAUGUAAGGAAGUGUGUGG
• Ensembl ID: ENSG00000207604
• HGNC ID: HGNC:31584
• Mature Accession: MIMAT0000462

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: MAPK2 signaling pathway; Regulation; hsa04011
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: BGC823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; EdU assay; Flow cytometry assay
• Mechanism Description: BGC823/DDP and SGC7901/DDP cell presented lower miR-206 than parental cells, plus higher MAPk3 mRNA or protein.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [2]

• Sensitive Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: MET/PI3K/AKT/mTOR signaling pathway; Regulation; hsa04150
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-206 overexpression in human lung adenocarcinoma cisplatin resistant cells inhibited the EMT and cisplatin resistance by targeting MET and suppressing its downstream PI3k/AkT/mTOR signaling pathway. Low expression of miR-206 and high levels of MET were strongly associated with the poor cisplatin sensitivity of lung adenocarcinoma patients. Therefore, activation of miR-206 or inactivation of its target gene pathway may be a potential strategy to reverse cisplatin resistance in human lung adenocarcinoma cisplatin resistant cells.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [3]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: RkO cells; Colon; Homo sapiens (Human); CVCL_0504
• In Vivo Model: SCID mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay; Flow cytometry assay
• Mechanism Description: miR-206 downregulation modulates 5-FU resistance in HCT116 cells by upregulating Bcl-2.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [4]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: As a potential tumor suppressor, miR206 directly targets CDk4 to suppress the cell growth and enhance the chemotherapy sensitivity to 5-Fu in ovarian cancer cells in vitro.

Levothyroxine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Papillary thyroid carcinoma [5]

• Sensitive Disease: Papillary thyroid carcinoma [ICD-11: 2D10.1]
• Sensitive Drug: Levothyroxine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: JNk signaling pathway; Inhibition; hsa04010
• Cell Pathway Regulation: p38 signaling pathway; Inhibition; hsa04010
• In Vitro Model: TPC-1 cells; Thyroid; Homo sapiens (Human); CVCL_6298
• In Vitro Model: Nthy-ori3-1 cells; Thyroid; Homo sapiens (Human); CVCL_2659
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; EdU assay; Flow cytometry assay
• Mechanism Description: Over-expression of miR-206 decreases the Euthyrox-resistance by targeting MAP4k3 in papillary thyroid carcinoma.

References

• Ref 1: MicroRNA-206 facilitates gastric cancer cell apoptosis and suppresses cisplatin resistance by targeting MAPK2 signaling pathway. Eur Rev Med Pharmacol Sci. 2019 Jan;23(1):171-180. doi: 10.26355/eurrev_201901_16761.
• Ref 2: miR-206 regulates cisplatin resistance and EMT in human lung adenocarcinoma cells partly by targeting MET. Oncotarget. 2016 Apr 26;7(17):24510-26. doi: 10.18632/oncotarget.8229.
• Ref 3: miR-206 regulates 5-FU resistance by targeting Bcl-2 in colon cancer cells. Onco Targets Ther. 2018 Mar 29;11:1757-1765. doi: 10.2147/OTT.S159093. eCollection 2018.
• Ref 4: [Role of miR-206/CDK4 in modulating the growth and chemotlerapy sensitivity of ovarian cancer cells]. Nan Fang Yi Ke Da Xue Xue Bao. 2017 Mar 20;37(3):393-397. doi: 10.3969/j.issn.1673-4254.2017.03.20.
• Ref 5: Over-expression of miR-206 decreases the Euthyrox-resistance by targeting MAP4K3 in papillary thyroid carcinoma. Biomed Pharmacother. 2019 Jun;114:108605. doi: 10.1016/j.biopha.2019.108605. Epub 2019 Mar 21.