Molecule Information

General Information of the Molecule (ID: Mol01619)
Name
hsa-miR-206 ,Homo sapiens
Synonyms
microRNA 206
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGGAAUGUAAGGAAGUGUGUGG
    Click to Show/Hide
Ensembl ID
ENSG00000207604
HGNC ID
HGNC:31584
Mature Accession
MIMAT0000462
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
Cell viability Activation hsa05200
MAPK2 signaling pathway Regulation N.A.
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
BGC823 cells Gastric Homo sapiens (Human) CVCL_3360
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; EdU assay; Flow cytometry assay
Mechanism Description BGC823/DDP and SGC7901/DDP cell presented lower miR-206 than parental cells, plus higher MAPk3 mRNA or protein.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [2]
Sensitive Disease Lung adenocarcinoma [ICD-11: 2C25.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
MET/PI3K/AKT/mTOR signaling pathway Regulation N.A.
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H1299 cells Lung Homo sapiens (Human) CVCL_0060
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-206 overexpression in human lung adenocarcinoma cisplatin resistant cells inhibited the EMT and cisplatin resistance by targeting MET and suppressing its downstream PI3k/AkT/mTOR signaling pathway. Low expression of miR-206 and high levels of MET were strongly associated with the poor cisplatin sensitivity of lung adenocarcinoma patients. Therefore, activation of miR-206 or inactivation of its target gene pathway may be a potential strategy to reverse cisplatin resistance in human lung adenocarcinoma cisplatin resistant cells.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [3]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation ERalpha signalling pathway Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
Experiment for
Drug Resistance		 CellTiter-Blue Cell Viability Assay (Promega)
Mechanism Description Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [4]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
RkO cells Colon Homo sapiens (Human) CVCL_0504
In Vivo Model SCID mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTS assay; Flow cytometry assay
Mechanism Description miR-206 downregulation modulates 5-FU resistance in HCT116 cells by upregulating Bcl-2.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [5]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description As a potential tumor suppressor, miR206 directly targets CDk4 to suppress the cell growth and enhance the chemotherapy sensitivity to 5-Fu in ovarian cancer cells in vitro.
Levothyroxine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] [6]
Sensitive Disease Papillary thyroid carcinoma [ICD-11: 2D10.1]
 Disease Info 
Sensitive Drug Levothyroxine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
Cell viability Inhibition hsa05200
JNk signaling pathway Inhibition hsa04010
p38 signaling pathway Inhibition hsa04010
In Vitro Model TPC-1 cells Thyroid Homo sapiens (Human) CVCL_6298
Nthy-ori3-1 cells Thyroid Homo sapiens (Human) CVCL_2659
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; EdU assay; Flow cytometry assay
Mechanism Description Over-expression of miR-206 decreases the Euthyrox-resistance by targeting MAP4k3 in papillary thyroid carcinoma.
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [7]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
 Disease Info 
Resistant Drug Sorafenib
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 RT-PCR; Western blot; Luciferase assay
Experiment for
Drug Resistance		 Cytotoxicity assay; Apoptosis assays
Mechanism Description Cellular expression of full-length HCV increases sensitivity to sorafenib by the miRNA-dependent modulation of Mcl-1 and apoptosis.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [8]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Verapamil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation MAPK signalling pathway Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
References
Ref 1 MicroRNA-206 facilitates gastric cancer cell apoptosis and suppresses cisplatin resistance by targeting MAPK2 signaling pathway. Eur Rev Med Pharmacol Sci. 2019 Jan;23(1):171-180. doi: 10.26355/eurrev_201901_16761.
Ref 2 miR-206 regulates cisplatin resistance and EMT in human lung adenocarcinoma cells partly by targeting MET. Oncotarget. 2016 Apr 26;7(17):24510-26. doi: 10.18632/oncotarget.8229.
Ref 3 Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
Ref 4 miR-206 regulates 5-FU resistance by targeting Bcl-2 in colon cancer cells. Onco Targets Ther. 2018 Mar 29;11:1757-1765. doi: 10.2147/OTT.S159093. eCollection 2018.
Ref 5 [Role of miR-206/CDK4 in modulating the growth and chemotlerapy sensitivity of ovarian cancer cells]. Nan Fang Yi Ke Da Xue Xue Bao. 2017 Mar 20;37(3):393-397. doi: 10.3969/j.issn.1673-4254.2017.03.20.
Ref 6 Over-expression of miR-206 decreases the Euthyrox-resistance by targeting MAP4K3 in papillary thyroid carcinoma. Biomed Pharmacother. 2019 Jun;114:108605. doi: 10.1016/j.biopha.2019.108605. Epub 2019 Mar 21.
Ref 7 Downregulation of miR-21 enhances chemotherapeutic effect of taxol in breast carcinoma cells. Technol Cancer Res Treat. 2010 Feb;9(1):77-86. doi: 10.1177/153303461000900109.
Ref 8 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.