Molecule Information
General Information of the Molecule (ID: Mol01618)
Name |
hsa-miR-195-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 195
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UAGCAGCACAGAAAUAUUGGC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [1] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell viability | Inhibition | hsa05200 | |
In Vitro Model | MkN28 cells | Gastric | Homo sapiens (Human) | CVCL_1416 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Overexpression of miR 195 5p inhibit multi drug resistance of gastric cancer cells via downregulating ZNF139. | |||
Disease Class: Colorectal cancer | [2] | |||
Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
Notch signaling pathway | Inhibition | hsa04330 | ||
In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
HT-29 cells | Colon | Homo sapiens (Human) | CVCL_0320 | |
HCT-160 cells | Colorectal | Homo sapiens (Human) | N.A. | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Caspase-3 activity | |||
Mechanism Description | miR-195-5p regulates CRC cell stemness and 5-FU resistance through Notch2 and RBPJ. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [1] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell viability | Inhibition | hsa05200 | |
In Vitro Model | MkN28 cells | Gastric | Homo sapiens (Human) | CVCL_1416 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Overexpression of miR 195 5p inhibit multi drug resistance of gastric cancer cells via downregulating ZNF139. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.