General Information of the Molecule (ID: Mol01618)
Name
hsa-miR-195-5p ,Homo sapiens
Synonyms
microRNA 195
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UAGCAGCACAGAAAUAUUGGC
    Click to Show/Hide
Ensembl ID
ENSG00000284112
HGNC ID
HGNC:31566
Mature Accession
MIMAT0000461
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Inhibition hsa05200
In Vitro Model MkN28 cells Gastric Homo sapiens (Human) CVCL_1416
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Overexpression of miR 195 5p inhibit multi drug resistance of gastric cancer cells via downregulating ZNF139.
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [2]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
Notch signaling pathway Inhibition hsa04330
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
SW620 cells Colon Homo sapiens (Human) CVCL_0547
HT-29 cells Colon Homo sapiens (Human) CVCL_0320
HCT-160 cells Colorectal Homo sapiens (Human) N.A.
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Caspase-3 activity
Mechanism Description miR-195-5p regulates CRC cell stemness and 5-FU resistance through Notch2 and RBPJ.
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Oxaliplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Inhibition hsa05200
In Vitro Model MkN28 cells Gastric Homo sapiens (Human) CVCL_1416
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Overexpression of miR 195 5p inhibit multi drug resistance of gastric cancer cells via downregulating ZNF139.
References
Ref 1 miR 195 5p regulates multi drug resistance of gastric cancer cells via targeting ZNF139. Oncol Rep. 2018 Sep;40(3):1370-1378. doi: 10.3892/or.2018.6524. Epub 2018 Jun 25.
Ref 2 Overcoming stemness and chemoresistance in colorectal cancer through miR-195-5p-modulated inhibition of notch signaling. Int J Biol Macromol. 2018 Oct 1;117:445-453. doi: 10.1016/j.ijbiomac.2018.05.151. Epub 2018 May 28.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.