Molecule Information
General Information of the Molecule (ID: Mol01617)
| Name |
hsa-miR-194-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 194-1
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UGUAACAGCAACUCCAUGUGGA
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.0] | [1] | |||
| Resistant Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.0] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | OE19 cells | Esophagus | Homo sapiens (Human) | CVCL_1622 |
| kYSE410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Mechanism Description | Chemotherapy resistant sublines were found to have specific miRNA signatures, and these miRNA signatures were different for the cisplatin vs 5-FU resistant cells from the same tumor cell line, and also for EAC vs ESCC cells with resistance to the same specific chemotherapy agent. Amongst others, miR-27b-3p, miR-193b-3p, miR-192-5p, miR-378 a-3p, miR-125a-5p and miR-18a-3p were dysregulated, consistent with negative posttranscriptional control of KRAS, TYMS, ABCC3, CBL-B and ERBB2 expression via these miRNAs. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [2] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
| In Vitro Model | Hey A8 cells | Ovary | Homo sapiens (Human) | CVCL_8878 |
| SkVO3ip1 cells | Ovary | Homo sapiens (Human) | CVCL_0C84 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | Down-regulation of miR-194-5p induces paclitaxel resistance in ovarian cancer cells by altering MDM2 expression. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
