Molecule Information

General Information of the Molecule (ID: Mol01617)

Name	hsa-miR-194-5p ,Homo sapiens
Synonyms	microRNA 194-1 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	UGUAACAGCAACUCCAUGUGGA Click to Show/Hide
Ensembl ID	ENSG00000207624
HGNC ID	HGNC:31564
Mature Accession	MIMAT0000460
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Fluorouracil

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.0]				[1]
Resistant Disease	Esophageal squamous cell carcinoma [ICD-11: 2B70.0]			Disease Info
Resistant Drug	Fluorouracil			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	OE19 cells	Esophagus	Homo sapiens (Human)	CVCL_1622
	kYSE410 cells	Esophagus	Homo sapiens (Human)	CVCL_1352
Experiment for Molecule Alteration	qPCR
Mechanism Description	Chemotherapy resistant sublines were found to have specific miRNA signatures, and these miRNA signatures were different for the cisplatin vs 5-FU resistant cells from the same tumor cell line, and also for EAC vs ESCC cells with resistance to the same specific chemotherapy agent. Amongst others, miR-27b-3p, miR-193b-3p, miR-192-5p, miR-378 a-3p, miR-125a-5p and miR-18a-3p were dysregulated, consistent with negative posttranscriptional control of KRAS, TYMS, ABCC3, CBL-B and ERBB2 expression via these miRNAs.

Paclitaxel

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0]				[2]
Resistant Disease	Ovarian cancer [ICD-11: 2C73.0]			Disease Info
Resistant Drug	Paclitaxel			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell viability		Activation	hsa05200
In Vitro Model	Hey A8 cells	Ovary	Homo sapiens (Human)	CVCL_8878
	SkVO3ip1 cells	Ovary	Homo sapiens (Human)	CVCL_0C84
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTS assay
Mechanism Description	Down-regulation of miR-194-5p induces paclitaxel resistance in ovarian cancer cells by altering MDM2 expression.

References

Ref 1	The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
Ref 2	Downregulation of miR-194-5p induces paclitaxel resistance in ovarian cancer cells by altering MDM2 expression. Oncotarget. 2019 Jan 18;10(6):673-683. doi: 10.18632/oncotarget.26586. eCollection 2019 Jan 18.