Molecule Information
General Information of the Molecule (ID: Mol01614)
Name |
hsa-miR-184
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 184
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UGGACGGAGAACUGAUAAGGGU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Oral squamous cell carcinoma | [1] | |||
Resistant Disease | Oral squamous cell carcinoma [ICD-11: 2B6E.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | Tca8113 cells | Tongue | Homo sapiens (Human) | CVCL_6851 |
CAL-27 cells | Tongue | Homo sapiens (Human) | CVCL_1107 | |
NHOk cells | Tongue | Homo sapiens (Human) | N.A. | |
SCC9 cells | Tongue | Homo sapiens (Human) | CVCL_1685 | |
TSCCA cells | Tongue | Homo sapiens (Human) | CVCL_VL15 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR; Dual luciferase reporter assay | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay; Caspase-3 activity analysis | |||
Mechanism Description | LncRNA UCA1 promotes proliferation and cisplatin resistance of oral squamous cell carcinoma by sunppressing miR-184 expression. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [2] | |||
Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | AKT/BCL2 signaling pathway | Regulation | hsa04933 | |
Cell apoptosis | Activation | hsa04210 | ||
NF-kappaB signaling pathway | Regulation | hsa04064 | ||
In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | microRNA-184 modulates doxorubicin resistance in osteosarcoma cells by targeting BCL2L1 and enhancing the level of it. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.