General Information of the Molecule (ID: Mol01614)
Name
hsa-miR-184 ,Homo sapiens
Synonyms
microRNA 184
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGGACGGAGAACUGAUAAGGGU
    Click to Show/Hide
Ensembl ID
ENSG00000207695
HGNC ID
HGNC:31555
Mature Accession
MIMAT0000454
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Oral squamous cell carcinoma [1]
Resistant Disease Oral squamous cell carcinoma [ICD-11: 2B6E.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Tca8113 cells Tongue Homo sapiens (Human) CVCL_6851
CAL-27 cells Tongue Homo sapiens (Human) CVCL_1107
NHOk cells Tongue Homo sapiens (Human) N.A.
SCC9 cells Tongue Homo sapiens (Human) CVCL_1685
TSCCA cells Tongue Homo sapiens (Human) CVCL_VL15
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR; Dual luciferase reporter assay
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay; Caspase-3 activity analysis
Mechanism Description LncRNA UCA1 promotes proliferation and cisplatin resistance of oral squamous cell carcinoma by sunppressing miR-184 expression.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [2]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT/BCL2 signaling pathway Regulation hsa04933
Cell apoptosis Activation hsa04210
NF-kappaB signaling pathway Regulation hsa04064
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
U2OS cells Bone Homo sapiens (Human) CVCL_0042
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description microRNA-184 modulates doxorubicin resistance in osteosarcoma cells by targeting BCL2L1 and enhancing the level of it.
References
Ref 1 LncRNA UCA1 promotes proliferation and cisplatin resistance of oral squamous cell carcinoma by sunppressing miR-184 expression. Cancer Med. 2017 Dec;6(12):2897-2908. doi: 10.1002/cam4.1253. Epub 2017 Nov 10.
Ref 2 MicroRNA-184 Modulates Doxorubicin Resistance in Osteosarcoma Cells by Targeting BCL2L1. Med Sci Monit. 2016 May 25;22:1761-5. doi: 10.12659/msm.896451.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.