Molecule Information

General Information of the Molecule (ID: Mol01614)

• Name: hsa-miR-184 ,Homo sapiens
• Synonyms: microRNA 184
• Molecule Type: Mature miRNA
• Sequence: UGGACGGAGAACUGAUAAGGGU
• Ensembl ID: ENSG00000207695
• HGNC ID: HGNC:31555
• Mature Accession: MIMAT0000454

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Oral squamous cell carcinoma [ICD-11: 2B6E.0] [1]

• Resistant Disease: Oral squamous cell carcinoma [ICD-11: 2B6E.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Tca8113 cells; Tongue; Homo sapiens (Human); CVCL_6851
• In Vitro Model: CAL-27 cells; Tongue; Homo sapiens (Human); CVCL_1107
• In Vitro Model: NHOk cells; Tongue; Homo sapiens (Human); N.A.
• In Vitro Model: SCC9 cells; Tongue; Homo sapiens (Human); CVCL_1685
• In Vitro Model: TSCCA cells; Tongue; Homo sapiens (Human); CVCL_VL15
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR; Dual luciferase reporter assay
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay; Caspase-3 activity analysis
• Mechanism Description: LncRNA UCA1 promotes proliferation and cisplatin resistance of oral squamous cell carcinoma by sunppressing miR-184 expression.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [ICD-11: 2B51.0] [2]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT/BCL2 signaling pathway; Regulation; N.A.
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: NF-kappaB signaling pathway; Regulation; N.A.
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: microRNA-184 modulates doxorubicin resistance in osteosarcoma cells by targeting BCL2L1 and enhancing the level of it.

References

• Ref 1: LncRNA UCA1 promotes proliferation and cisplatin resistance of oral squamous cell carcinoma by sunppressing miR-184 expression. Cancer Med. 2017 Dec;6(12):2897-2908. doi: 10.1002/cam4.1253. Epub 2017 Nov 10.
• Ref 2: MicroRNA-184 Modulates Doxorubicin Resistance in Osteosarcoma Cells by Targeting BCL2L1. Med Sci Monit. 2016 May 25;22:1761-5. doi: 10.12659/msm.896451.