Molecule Information
General Information of the Molecule (ID: Mol01612)
| Name |
hsa-miR-146a-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 146a
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UGAGAACUGAAUUCCAUGGGUU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [1] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| A549/DDP cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR146a-5p increases chemosensitivity of NSCLC to cisplatin by targeting Atg12 to inhibit autophagy. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [2] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| OVCAR3 cells | Ovary | Homo sapiens (Human) | CVCL_0465 | |
| Experiment for Molecule Alteration |
Dual-luciferase assay | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | microRNA 146a 5p enhances cisplatin induced apoptosis in ovarian cancer cells by targeting multiple anti apoptotic genes, including XIAP, BCL2L2 and BIRC5 via their 3'UTRs. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [3] | |||
| Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Resistant Drug | Vincristine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCT-8 cells | Colon | Homo sapiens (Human) | CVCL_2478 |
| Experiment for Molecule Alteration |
Whole-genome screens | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | This gene is down-regulated in vincristine-resistance cells | |||
Clinical Trial Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] | [3] | |||
| Resistant Disease | Papillary thyroid carcinoma [ICD-11: 2D10.1] | |||
| Resistant Drug | PLX4720 | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Experiment for Molecule Alteration |
Immunoblot analysis; qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | This gene is up-regulated in PLX4720-resistance cells | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
