General Information of the Molecule (ID: Mol01612)
Name
hsa-miR-146a-5p ,Homo sapiens
Synonyms
microRNA 146a
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGAGAACUGAAUUCCAUGGGUU
    Click to Show/Hide
Ensembl ID
ENSG00000283733
HGNC ID
HGNC:31533
Mature Accession
MIMAT0000449
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/DDP cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR146a-5p increases chemosensitivity of NSCLC to cisplatin by targeting Atg12 to inhibit autophagy.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
Experiment for
Molecule Alteration
Dual-luciferase assay
Experiment for
Drug Resistance
MTT assay
Mechanism Description microRNA 146a 5p enhances cisplatin induced apoptosis in ovarian cancer cells by targeting multiple anti apoptotic genes, including XIAP, BCL2L2 and BIRC5 via their 3'UTRs.
References
Ref 1 MiR-146a-5p level in serum exosomes predicts therapeutic effect of cisplatin in non-small cell lung cancer. Eur Rev Med Pharmacol Sci. 2017 Jun;21(11):2650-2658.
Ref 2 MicroRNA 146a 5p enhances cisplatin induced apoptosis in ovarian cancer cells by targeting multiple anti apoptotic genes. Int J Oncol. 2017 Jul;51(1):327-335. doi: 10.3892/ijo.2017.4023. Epub 2017 May 29.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.