Molecule Information

General Information of the Molecule (ID: Mol01610)

• Name: hsa-miR-127-3p ,Homo sapiens
• Synonyms: microRNA 127
• Molecule Type: Mature miRNA
• Sequence: UCGGAUCCGUCUGAGCUUGGCU
• Ensembl ID: ENSG00000207608
• HGNC ID: HGNC:31509
• Mature Accession: MIMAT0000446

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Investigative Drug(s) 1 drug(s) in total

2-Bromo-4-fluorobenzaldehyde

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal cancer [1]

• Sensitive Disease: Esophageal cancer [ICD-11: 2B70.1]
• Sensitive Drug: 2-Bromo-4-fluorobenzaldehyde
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: TE-1 cells; Esophagus; Homo sapiens (Human); CVCL_1759
• In Vitro Model: 293T cells; Breast; Homo sapiens (Human); CVCL_0063
• In Vitro Model: EC9706 cells; Esophagus; Homo sapiens (Human); CVCL_E307
• In Vitro Model: KYSE150 cells; Esophagus; Homo sapiens (Human); CVCL_1348
• In Vitro Model: EC109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• In Vitro Model: EC1 cells; Esophagus; Homo sapiens (Human); CVCL_DC74
• In Vitro Model: HEEC cells; Esophagus; Homo sapiens (Human); N.A.
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miroRNA-127-3p targets XRCC3 to enhance the chemosensitivity of esophageal cancer cells to a novel phenanthroline-dione derivative.

References

• Ref 1: MiroRNA-127-3p targets XRCC3 to enhance the chemosensitivity of esophageal cancer cells to a novel phenanthroline-dione derivative. Int J Biochem Cell Biol. 2016 Oct;79:158-167. doi: 10.1016/j.biocel.2016.08.026. Epub 2016 Aug 30.