Molecule Information

General Information of the Molecule (ID: Mol01610)

• Name: hsa-miR-127-3p ,Homo sapiens
• Synonyms: microRNA 127
• Molecule Type: Mature miRNA
• Sequence: UCGGAUCCGUCUGAGCUUGGCU
• Ensembl ID: ENSG00000207608
• HGNC ID: HGNC:31509
• Mature Accession: MIMAT0000446

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [1]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: SNU182 cells; Liver; Homo sapiens (Human); CVCL_0090
• In Vitro Model: SNU-739 cells; Liver; Homo sapiens (Human); CVCL_5088
• In Vitro Model: 769-P cells; Kidney; Homo sapiens (Human); CVCL_1050
• In Vitro Model: 786-O cells; Kidney; Homo sapiens (Human); CVCL_1051
• In Vivo Model: Immunodeficient mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Luciferase assay
• Experiment for Drug Resistance: Cell cycle analysis; Apoptosis analysis
• Mechanism Description: This gene is up-regulated in doxorubicin-sensitive cells

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [1]

• Sensitive Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: SNU182 cells; Liver; Homo sapiens (Human); CVCL_0090
• In Vitro Model: SNU-739 cells; Liver; Homo sapiens (Human); CVCL_5088
• In Vitro Model: 769-P cells; Kidney; Homo sapiens (Human); CVCL_1050
• In Vitro Model: 786-O cells; Kidney; Homo sapiens (Human); CVCL_1051
• In Vivo Model: Immunodeficient mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Luciferase assay
• Experiment for Drug Resistance: Cell cycle analysis; Apoptosis analysis
• Mechanism Description: This gene is up-regulated in doxorubicin-sensitive cells

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: qRT-PCR, Reverse Transcription and Running ABC Transporter TLDA
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Using miRNA microfluidic arrays from ABI, we determined the microRNA profile for MCF7VP cells compared to drug sensitive cells. Multiple miRNAs showed differential expression among the cell lines including hsa-miR-382, hsa-miR-23b and hsa-miR-885-5p, which were up-regulated (>2-fold increase) in MCF7VP cells and hsa-mir-218, hsa-miR-758 and hsa-miR-548d-5p, which were down-regulated (>2-fold decrease) in MCF7VP cells, suggesting that etoposide resistant MCF7 cells have a miRNA profile that is distinct from the MCF7 drug sensitive cell line.

Investigative Drug(s) 1 drug(s) in total

2-Bromo-4-fluorobenzaldehyde

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal cancer [ICD-11: 2B70.1] [3]

• Sensitive Disease: Esophageal cancer [ICD-11: 2B70.1]
• Sensitive Drug: 2-Bromo-4-fluorobenzaldehyde
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: TE-1 cells; Esophagus; Homo sapiens (Human); CVCL_1759
• In Vitro Model: 293T cells; Breast; Homo sapiens (Human); CVCL_0063
• In Vitro Model: EC9706 cells; Esophagus; Homo sapiens (Human); CVCL_E307
• In Vitro Model: KYSE150 cells; Esophagus; Homo sapiens (Human); CVCL_1348
• In Vitro Model: EC109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• In Vitro Model: EC1 cells; Esophagus; Homo sapiens (Human); CVCL_DC74
• In Vitro Model: HEEC cells; Esophagus; Homo sapiens (Human); N.A.
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miroRNA-127-3p targets XRCC3 to enhance the chemosensitivity of esophageal cancer cells to a novel phenanthroline-dione derivative.

References

• Ref 1: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 2: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 3: MiroRNA-127-3p targets XRCC3 to enhance the chemosensitivity of esophageal cancer cells to a novel phenanthroline-dione derivative. Int J Biochem Cell Biol. 2016 Oct;79:158-167. doi: 10.1016/j.biocel.2016.08.026. Epub 2016 Aug 30.