Molecule Information
General Information of the Molecule (ID: Mol01608)
| Name |
hsa-miR-126-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 126
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
CAUUAUUACUUUUGGUACGCG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Acute myeloid leukemia | [1] | |||
| Sensitive Disease | Acute myeloid leukemia [ICD-11: 2A60.0] | |||
| Sensitive Drug | Cytarabine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | AKTsignaling pathway | Inhibition | hsa04151 | |
| Cell apoptosis | Activation | hsa04210 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | KG-1 cells | Bone marrow | Homo sapiens (Human) | CVCL_0374 |
| K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 | |
| HK-2 cells | Kidney | Homo sapiens (Human) | CVCL_0302 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Transfection of the mimic miR-126-5p into the AML cell line, kG-1, resulted in a decrease in the sensitivity to cytarabin and the expression level of klotho mRNA as well as the elevation in the phosphorylation of Akt. The results of the present study demonstrated that higher expression levels of miR-126-5p/3p in patients with AML resulted in a poorer prognosis. Furthermore, miR-126-5p elevated the phosphorylation of Akt. | |||
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.
