General Information of the Molecule (ID: Mol01608)
Name
hsa-miR-126-5p ,Homo sapiens
Synonyms
microRNA 126
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CAUUAUUACUUUUGGUACGCG
    Click to Show/Hide
Ensembl ID
ENSG00000199161
HGNC ID
HGNC:31508
Mature Accession
MIMAT0000444
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cytarabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Acute myeloid leukemia [ICD-11: 2A60.0] [1]
Sensitive Disease Acute myeloid leukemia [ICD-11: 2A60.0]
Sensitive Drug Cytarabine
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation AKTsignaling pathway Inhibition hsa04151
Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model KG-1 cells Bone marrow Homo sapiens (Human) CVCL_0374
K562 cells Blood Homo sapiens (Human) CVCL_0004
HK-2 cells Kidney Homo sapiens (Human) CVCL_0302
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Transfection of the mimic miR-126-5p into the AML cell line, kG-1, resulted in a decrease in the sensitivity to cytarabin and the expression level of klotho mRNA as well as the elevation in the phosphorylation of Akt. The results of the present study demonstrated that higher expression levels of miR-126-5p/3p in patients with AML resulted in a poorer prognosis. Furthermore, miR-126-5p elevated the phosphorylation of Akt.
References
Ref 1 Upregulation of microRNA-126-5p is associated with drug resistance to cytarabine and poor prognosis in AML patients. Oncol Rep. 2015 May;33(5):2176-82. doi: 10.3892/or.2015.3839. Epub 2015 Mar 6.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.