Molecule Information
General Information of the Molecule (ID: Mol01606)
Name |
hsa-miR-145-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 145
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
GUCCAGUUUUCCCAGGAAUCCCU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [1] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | FAO signaling pathway | Activation | hsa04550 | |
In Vitro Model | AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Colony formation assays | |||
Mechanism Description | Transforming growth factor beta1 (TGF-beta1) secretion by MSCs activated SMAD2/3 through TGF-beta receptors and induced long non-coding RNA (LncRNA) MACC1-AS1 expression in GC cells, which promoted FAO-dependent stemness and chemoresistance through antagonizing miR-145-5p. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [1] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | FAO signaling pathway | Activation | hsa04550 | |
In Vitro Model | AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Colony formation assays | |||
Mechanism Description | Transforming growth factor beta1 (TGF-beta1) secretion by MSCs activated SMAD2/3 through TGF-beta receptors and induced long non-coding RNA (LncRNA) MACC1-AS1 expression in GC cells, which promoted FAO-dependent stemness and chemoresistance through antagonizing miR-145-5p. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.