General Information of the Molecule (ID: Mol01606)
Name
hsa-miR-145-5p ,Homo sapiens
Synonyms
microRNA 145
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
GUCCAGUUUUCCCAGGAAUCCCU
    Click to Show/Hide
Ensembl ID
ENSG00000276365
HGNC ID
HGNC:31532
Mature Accession
MIMAT0000437
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation FAO signaling pathway Activation hsa04550
In Vitro Model AGS cells Gastric Homo sapiens (Human) CVCL_0139
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Colony formation assays
Mechanism Description Transforming growth factor beta1 (TGF-beta1) secretion by MSCs activated SMAD2/3 through TGF-beta receptors and induced long non-coding RNA (LncRNA) MACC1-AS1 expression in GC cells, which promoted FAO-dependent stemness and chemoresistance through antagonizing miR-145-5p.
Oxaliplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Oxaliplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation FAO signaling pathway Activation hsa04550
In Vitro Model AGS cells Gastric Homo sapiens (Human) CVCL_0139
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Colony formation assays
Mechanism Description Transforming growth factor beta1 (TGF-beta1) secretion by MSCs activated SMAD2/3 through TGF-beta receptors and induced long non-coding RNA (LncRNA) MACC1-AS1 expression in GC cells, which promoted FAO-dependent stemness and chemoresistance through antagonizing miR-145-5p.
References
Ref 1 MSC-regulated lncRNA MACC1-AS1 promotes stemness and chemoresistance through fatty acid oxidation in gastric cancer. Oncogene. 2019 Jun;38(23):4637-4654. doi: 10.1038/s41388-019-0747-0. Epub 2019 Feb 11.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.