Molecule Information

General Information of the Molecule (ID: Mol01606)

Name	hsa-miR-145-5p ,Homo sapiens
Synonyms	microRNA 145 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	GUCCAGUUUUCCCAGGAAUCCCU Click to Show/Hide
Ensembl ID	ENSG00000276365
HGNC ID	HGNC:31532
Mature Accession	MIMAT0000437
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Fluorouracil

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Regulation by the Disease Microenvironment (RTDM)			Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1]				[1]
Resistant Disease	Gastric cancer [ICD-11: 2B72.1]			Disease Info
Resistant Drug	Fluorouracil			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	FAO signaling pathway		Activation	hsa04550
In Vitro Model	AGS cells	Gastric	Homo sapiens (Human)	CVCL_0139
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay; Colony formation assays
Mechanism Description	Transforming growth factor beta1 (TGF-beta1) secretion by MSCs activated SMAD2/3 through TGF-beta receptors and induced long non-coding RNA (LncRNA) MACC1-AS1 expression in GC cells, which promoted FAO-dependent stemness and chemoresistance through antagonizing miR-145-5p.

Oxaliplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Regulation by the Disease Microenvironment (RTDM)			Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1]				[1]
Resistant Disease	Gastric cancer [ICD-11: 2B72.1]			Disease Info
Resistant Drug	Oxaliplatin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	FAO signaling pathway		Activation	hsa04550
In Vitro Model	AGS cells	Gastric	Homo sapiens (Human)	CVCL_0139
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay; Colony formation assays
Mechanism Description	Transforming growth factor beta1 (TGF-beta1) secretion by MSCs activated SMAD2/3 through TGF-beta receptors and induced long non-coding RNA (LncRNA) MACC1-AS1 expression in GC cells, which promoted FAO-dependent stemness and chemoresistance through antagonizing miR-145-5p.

References

Ref 1	MSC-regulated lncRNA MACC1-AS1 promotes stemness and chemoresistance through fatty acid oxidation in gastric cancer. Oncogene. 2019 Jun;38(23):4637-4654. doi: 10.1038/s41388-019-0747-0. Epub 2019 Feb 11.