Molecule Information

General Information of the Molecule (ID: Mol01605)

• Name: hsa-miR-144-3p ,Homo sapiens
• Synonyms: microRNA 144
• Molecule Type: Mature miRNA
• Sequence: UACAGUAUAGAUGAUGUACU
• Ensembl ID: ENSG00000283819
• HGNC ID: HGNC:31531
• Mature Accession: MIMAT0000436

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [ICD-11: 2C25.5] [1]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: Nrf2 signaling pathway; Inhibition; hsa05208
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: Cos-7 cells; Lung; Homo sapiens (Human); CVCL_0224
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-144-3p promotes cisplatin sensitivity by downregulating Nrf2 in lung cancer cells.

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Clear cell renal cell carcinoma [ICD-11: 2C90.Y] [2]

• Resistant Disease: Clear cell renal cell carcinoma [ICD-11: 2C90.Y]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell metastasis; Activation; hsa05205
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Chemoresistance; Activation; hsa05207
• In Vitro Model: 786-O cells; Kidney; Homo sapiens (Human); CVCL_1051
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR144-3p promotes cell proliferation, metastasis, sunitinib resistance in clear cell renal cell carcinoma by downregulating ARID1A. and the downregulation of ARIDIA could promote the function of mir144-3p in cell proliferation, metastasis and chemoresistance.

References

• Ref 1: miR 144 3p regulates the resistance of lung cancer to cisplatin by targeting Nrf2. Oncol Rep. 2018 Dec;40(6):3479-3488. doi: 10.3892/or.2018.6772. Epub 2018 Oct 8.
• Ref 2: Mir-144-3p Promotes Cell Proliferation, Metastasis, Sunitinib Resistance in Clear Cell Renal Cell Carcinoma by Downregulating ARID1A. Cell Physiol Biochem. 2017;43(6):2420-2433. doi: 10.1159/000484395. Epub 2017 Oct 27.