Molecule Information
General Information of the Molecule (ID: Mol01604)
| Name |
hsa-miR-143-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 143
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UGAGAUGAAGCACUGUAGCUC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] | [1] | |||
| Resistant Disease | Renal cell carcinoma [ICD-11: 2C90.0] | |||
| Resistant Drug | Sunitinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cancer progression | Inhibition | hsa05200 | |
| In Vitro Model | Caki-1 cells | Kidney | Homo sapiens (Human) | CVCL_0234 |
| 786-O cells | Kidney | Homo sapiens (Human) | CVCL_1051 | |
| 769-P cells | Kidney | Homo sapiens (Human) | CVCL_1050 | |
| A498 cells | Kidney | Homo sapiens (Human) | CVCL_1056 | |
| Caki-2 cells | Kidney | Homo sapiens (Human) | CVCL_0235 | |
| Hk-2 cells | Kidney | Homo sapiens (Human) | CVCL_0302 | |
| OSRC-2 cells | Kidney | Homo sapiens (Human) | CVCL_1626 | |
| SW839 cells | Kidney | Homo sapiens (Human) | CVCL_3604 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR; RNA pull-down assay; ChIP assay | |||
| Experiment for Drug Resistance |
MTT assay; Wound-healing assay; Transwell assay | |||
| Mechanism Description | LncRNA-SARCC bound and destabilized AR protein with an inhibition of AR function, which led to transcriptionally de-repress miR143-3p expression, thus inhibition of its downstream signals including AkT, MMP-13, k-RAS and P-ERk. Increased the expression of LncRNA-SARCC decreased RCC cells resistance to Sunitinib. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
