Molecule Information

General Information of the Molecule (ID: Mol01604)

• Name: hsa-miR-143-3p ,Homo sapiens
• Synonyms: microRNA 143
• Molecule Type: Mature miRNA
• Sequence: UGAGAUGAAGCACUGUAGCUC
• Ensembl ID: ENSG00000284182
• HGNC ID: HGNC:31530
• Mature Accession: MIMAT0000435

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [1]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cancer progression; Inhibition; hsa05200
• In Vitro Model: Caki-1 cells; Kidney; Homo sapiens (Human); CVCL_0234
• In Vitro Model: 786-O cells; Kidney; Homo sapiens (Human); CVCL_1051
• In Vitro Model: 769-P cells; Kidney; Homo sapiens (Human); CVCL_1050
• In Vitro Model: A498 cells; Kidney; Homo sapiens (Human); CVCL_1056
• In Vitro Model: Caki-2 cells; Kidney; Homo sapiens (Human); CVCL_0235
• In Vitro Model: Hk2 cells; Kidney; Homo sapiens (Human); CVCL_0302
• In Vitro Model: OSRC-2 cells; Kidney; Homo sapiens (Human); CVCL_1626
• In Vitro Model: SW839 cells; Kidney; Homo sapiens (Human); CVCL_3604
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; RNA pull-down assay; ChIP assay
• Experiment for Drug Resistance: MTT assay; Wound-healing assay; Transwell assay
• Mechanism Description: LncRNA-SARCC bound and destabilized AR protein with an inhibition of AR function, which led to transcriptionally de-repress miR143-3p expression, thus inhibition of its downstream signals including AkT, MMP-13, k-RAS and P-ERk. Increased the expression of LncRNA-SARCC decreased RCC cells resistance to Sunitinib.

References

• Ref 1: LncRNA-SARCC suppresses renal cell carcinoma (RCC) progression via altering the androgen receptor(AR)/miRNA-143-3p signals. Cell Death Differ. 2017 Sep;24(9):1502-1517. doi: 10.1038/cdd.2017.74. Epub 2017 Jun 23.