Molecule Information
General Information of the Molecule (ID: Mol01604)
Name |
hsa-miR-143-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 143
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UGAGAUGAAGCACUGUAGCUC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Renal cell carcinoma | [1] | |||
Resistant Disease | Renal cell carcinoma [ICD-11: 2C90.0] | |||
Resistant Drug | Sunitinib | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cancer progression | Inhibition | hsa05200 | |
In Vitro Model | Caki-1 cells | Kidney | Homo sapiens (Human) | CVCL_0234 |
786-O cells | Kidney | Homo sapiens (Human) | CVCL_1051 | |
769-P cells | Kidney | Homo sapiens (Human) | CVCL_1050 | |
A498 cells | Kidney | Homo sapiens (Human) | CVCL_1056 | |
Caki-2 cells | Kidney | Homo sapiens (Human) | CVCL_0235 | |
Hk2 cells | Kidney | Homo sapiens (Human) | CVCL_0302 | |
OSRC-2 cells | Kidney | Homo sapiens (Human) | CVCL_1626 | |
SW839 cells | Kidney | Homo sapiens (Human) | CVCL_3604 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR; RNA pull-down assay; ChIP assay | |||
Experiment for Drug Resistance |
MTT assay; Wound-healing assay; Transwell assay | |||
Mechanism Description | LncRNA-SARCC bound and destabilized AR protein with an inhibition of AR function, which led to transcriptionally de-repress miR143-3p expression, thus inhibition of its downstream signals including AkT, MMP-13, k-RAS and P-ERk. Increased the expression of LncRNA-SARCC decreased RCC cells resistance to Sunitinib. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.