Molecule Information
General Information of the Molecule (ID: Mol01601)
Name |
hsa-miR-141-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 141
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UAACACUGUCUGGUAAAGAUGG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Esophageal cancer | [1] | |||
Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | TE-1 cells | Esophagus | Homo sapiens (Human) | CVCL_1759 |
EC9706 cells | Esophagus | Homo sapiens (Human) | CVCL_E307 | |
KYSE150 cells | Esophagus | Homo sapiens (Human) | CVCL_1348 | |
EC109 cells | Esophagus | Homo sapiens (Human) | CVCL_6898 | |
EC9706-R cells | Esophagus | Homo sapiens (Human) | CVCL_E307 | |
Het-1A cells | Esophagus | Homo sapiens (Human) | CVCL_3702 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Annexin V-FITC Apoptosis Detection assay | |||
Mechanism Description | Involvement of microRNA-141-3p in 5-fluorouracil and oxaliplatin chemo-resistance in esophageal cancer cells via down-regulation of PTEN. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Esophageal cancer | [1] | |||
Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
Resistant Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | TE-1 cells | Esophagus | Homo sapiens (Human) | CVCL_1759 |
EC9706 cells | Esophagus | Homo sapiens (Human) | CVCL_E307 | |
KYSE150 cells | Esophagus | Homo sapiens (Human) | CVCL_1348 | |
EC109 cells | Esophagus | Homo sapiens (Human) | CVCL_6898 | |
EC9706-R cells | Esophagus | Homo sapiens (Human) | CVCL_E307 | |
Het-1A cells | Esophagus | Homo sapiens (Human) | CVCL_3702 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Annexin V-FITC Apoptosis Detection assay | |||
Mechanism Description | Involvement of microRNA-141-3p in 5-fluorouracil and oxaliplatin chemo-resistance in esophageal cancer cells via down-regulation of PTEN. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [2] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Trastuzumab | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell invasion | Activation | hsa05200 | ||
Cell migration | Activation | hsa04670 | ||
Cell proliferation | Activation | hsa05200 | ||
miR141-3p/CDk8 signaling pathway | Inhibition | hsa05206 | ||
In Vitro Model | SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 |
MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 | |
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | miR-141-3p could restore the sensitivity to trastuzumab in breast cancer cells by repressing CDk8, which might regulate the phosphorylation levels of SMAD2/SMAD3 via TGF-beta. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.