Molecule Information

General Information of the Molecule (ID: Mol01601)

• Name: hsa-miR-141-3p ,Homo sapiens
• Synonyms: microRNA 141
• Molecule Type: Mature miRNA
• Sequence: UAACACUGUCUGGUAAAGAUGG
• Ensembl ID: ENSG00000207708
• HGNC ID: HGNC:31528
• Mature Accession: MIMAT0000432

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal cancer [1]

• Resistant Disease: Esophageal cancer [ICD-11: 2B70.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: TE-1 cells; Esophagus; Homo sapiens (Human); CVCL_1759
• In Vitro Model: EC9706 cells; Esophagus; Homo sapiens (Human); CVCL_E307
• In Vitro Model: KYSE150 cells; Esophagus; Homo sapiens (Human); CVCL_1348
• In Vitro Model: EC109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• In Vitro Model: EC9706-R cells; Esophagus; Homo sapiens (Human); CVCL_E307
• In Vitro Model: Het-1A cells; Esophagus; Homo sapiens (Human); CVCL_3702
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Annexin V-FITC Apoptosis Detection assay
• Mechanism Description: Involvement of microRNA-141-3p in 5-fluorouracil and oxaliplatin chemo-resistance in esophageal cancer cells via down-regulation of PTEN.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal cancer [1]

• Resistant Disease: Esophageal cancer [ICD-11: 2B70.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: TE-1 cells; Esophagus; Homo sapiens (Human); CVCL_1759
• In Vitro Model: EC9706 cells; Esophagus; Homo sapiens (Human); CVCL_E307
• In Vitro Model: KYSE150 cells; Esophagus; Homo sapiens (Human); CVCL_1348
• In Vitro Model: EC109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• In Vitro Model: EC9706-R cells; Esophagus; Homo sapiens (Human); CVCL_E307
• In Vitro Model: Het-1A cells; Esophagus; Homo sapiens (Human); CVCL_3702
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Annexin V-FITC Apoptosis Detection assay
• Mechanism Description: Involvement of microRNA-141-3p in 5-fluorouracil and oxaliplatin chemo-resistance in esophageal cancer cells via down-regulation of PTEN.

Trastuzumab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Trastuzumab
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: miR141-3p/CDk8 signaling pathway; Inhibition; hsa05206
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-141-3p could restore the sensitivity to trastuzumab in breast cancer cells by repressing CDk8, which might regulate the phosphorylation levels of SMAD2/SMAD3 via TGF-beta.

References

• Ref 1: Involvement of microRNA-141-3p in 5-fluorouracil and oxaliplatin chemo-resistance in esophageal cancer cells via regulation of PTEN. Mol Cell Biochem. 2016 Nov;422(1-2):161-170. doi: 10.1007/s11010-016-2816-9. Epub 2016 Sep 19.
• Ref 2: The microRNA-141-3p/ CDK8 pathway regulates the chemosensitivity of breast cancer cells to trastuzumab. J Cell Biochem. 2019 Aug;120(8):14095-14106. doi: 10.1002/jcb.28685. Epub 2019 May 14.