General Information of the Molecule (ID: Mol01601)
Name
hsa-miR-141-3p ,Homo sapiens
Synonyms
microRNA 141
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UAACACUGUCUGGUAAAGAUGG
    Click to Show/Hide
Ensembl ID
ENSG00000207708
HGNC ID
HGNC:31528
Mature Accession
MIMAT0000432
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal cancer [1]
Resistant Disease Esophageal cancer [ICD-11: 2B70.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model TE-1 cells Esophagus Homo sapiens (Human) CVCL_1759
EC9706 cells Esophagus Homo sapiens (Human) CVCL_E307
KYSE150 cells Esophagus Homo sapiens (Human) CVCL_1348
EC109 cells Esophagus Homo sapiens (Human) CVCL_6898
EC9706-R cells Esophagus Homo sapiens (Human) CVCL_E307
Het-1A cells Esophagus Homo sapiens (Human) CVCL_3702
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Annexin V-FITC Apoptosis Detection assay
Mechanism Description Involvement of microRNA-141-3p in 5-fluorouracil and oxaliplatin chemo-resistance in esophageal cancer cells via down-regulation of PTEN.
Oxaliplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal cancer [1]
Resistant Disease Esophageal cancer [ICD-11: 2B70.1]
Resistant Drug Oxaliplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model TE-1 cells Esophagus Homo sapiens (Human) CVCL_1759
EC9706 cells Esophagus Homo sapiens (Human) CVCL_E307
KYSE150 cells Esophagus Homo sapiens (Human) CVCL_1348
EC109 cells Esophagus Homo sapiens (Human) CVCL_6898
EC9706-R cells Esophagus Homo sapiens (Human) CVCL_E307
Het-1A cells Esophagus Homo sapiens (Human) CVCL_3702
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Annexin V-FITC Apoptosis Detection assay
Mechanism Description Involvement of microRNA-141-3p in 5-fluorouracil and oxaliplatin chemo-resistance in esophageal cancer cells via down-regulation of PTEN.
Trastuzumab
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [2]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Trastuzumab
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
miR141-3p/CDk8 signaling pathway Inhibition hsa05206
In Vitro Model SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
HEK293T cells Kidney Homo sapiens (Human) CVCL_0063
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR-141-3p could restore the sensitivity to trastuzumab in breast cancer cells by repressing CDk8, which might regulate the phosphorylation levels of SMAD2/SMAD3 via TGF-beta.
References
Ref 1 Involvement of microRNA-141-3p in 5-fluorouracil and oxaliplatin chemo-resistance in esophageal cancer cells via regulation of PTEN. Mol Cell Biochem. 2016 Nov;422(1-2):161-170. doi: 10.1007/s11010-016-2816-9. Epub 2016 Sep 19.
Ref 2 The microRNA-141-3p/ CDK8 pathway regulates the chemosensitivity of breast cancer cells to trastuzumab. J Cell Biochem. 2019 Aug;120(8):14095-14106. doi: 10.1002/jcb.28685. Epub 2019 May 14.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.