Molecule Information
General Information of the Molecule (ID: Mol01601)
| Name |
hsa-miR-141-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 141
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UAACACUGUCUGGUAAAGAUGG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal cancer [ICD-11: 2B70.1] | [1] | |||
| Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | TE-1 cells | Esophagus | Homo sapiens (Human) | CVCL_1759 |
| EC9706 cells | Esophagus | Homo sapiens (Human) | CVCL_E307 | |
| KYSE150 cells | Esophagus | Homo sapiens (Human) | CVCL_1348 | |
| EC109 cells | Esophagus | Homo sapiens (Human) | CVCL_6898 | |
| EC9706-R cells | Esophagus | Homo sapiens (Human) | CVCL_E307 | |
| Het-1A cells | Esophagus | Homo sapiens (Human) | CVCL_3702 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Annexin V-FITC Apoptosis Detection assay | |||
| Mechanism Description | Involvement of microRNA-141-3p in 5-fluorouracil and oxaliplatin chemo-resistance in esophageal cancer cells via down-regulation of PTEN. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal cancer [ICD-11: 2B70.1] | [1] | |||
| Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
| Resistant Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | TE-1 cells | Esophagus | Homo sapiens (Human) | CVCL_1759 |
| EC9706 cells | Esophagus | Homo sapiens (Human) | CVCL_E307 | |
| KYSE150 cells | Esophagus | Homo sapiens (Human) | CVCL_1348 | |
| EC109 cells | Esophagus | Homo sapiens (Human) | CVCL_6898 | |
| EC9706-R cells | Esophagus | Homo sapiens (Human) | CVCL_E307 | |
| Het-1A cells | Esophagus | Homo sapiens (Human) | CVCL_3702 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Annexin V-FITC Apoptosis Detection assay | |||
| Mechanism Description | Involvement of microRNA-141-3p in 5-fluorouracil and oxaliplatin chemo-resistance in esophageal cancer cells via down-regulation of PTEN. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Trastuzumab | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell invasion | Activation | hsa05200 | ||
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| miR141-3p/CDk8 signaling pathway | Inhibition | hsa05206 | ||
| In Vitro Model | SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | miR-141-3p could restore the sensitivity to trastuzumab in breast cancer cells by repressing CDk8, which might regulate the phosphorylation levels of SMAD2/SMAD3 via TGF-beta. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
