Molecule Information
General Information of the Molecule (ID: Mol01600)
| Name |
hsa-miR-140-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 140
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
CAGUGGUUUUACCCUAUGGUAG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [1] | |||
| Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell autophagy | Activation | hsa04140 | |
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
| hFOB1.19 cells | Fetal bone | Homo sapiens (Human) | CVCL_3708 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
IC50 assay; Flow cytometric analysis | |||
| Mechanism Description | miR140-5p/HMGN5/autophagy regulatory loop plays a critical role in chemoresistance in osteosarcoma, miR 140-5p regulates osteosarcoma chemoresistance by targeting HMGN5 and autophagy. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Multiple myeloma [ICD-11: 2A83.0] | [2] | |||
| Resistant Disease | Multiple myeloma [ICD-11: 2A83.0] | |||
| Resistant Drug | Melphalan | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell autophagy | Activation | hsa04140 | ||
| Cell viability | Activation | hsa05200 | ||
| In Vitro Model | KMS11 cells | Peripheral blood | Homo sapiens (Human) | CVCL_2989 |
| LP1 cells | Bone marrow | Homo sapiens (Human) | CVCL_0012 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | Linc00515 enhanced autophagy and chemoresistance of melphalan-resistant myeloma by directly inhibiting miR-140-5p, which elevated ATG14 level. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Multiple myeloma [ICD-11: 2A83.0] | [2] | |||
| Sensitive Disease | Multiple myeloma [ICD-11: 2A83.0] | |||
| Sensitive Drug | Melphalan | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell autophagy | Activation | hsa04140 | ||
| Cell viability | Activation | hsa05200 | ||
| In Vitro Model | KMS11 cells | Peripheral blood | Homo sapiens (Human) | CVCL_2989 |
| LP1 cells | Bone marrow | Homo sapiens (Human) | CVCL_0012 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | Linc00515 enhanced autophagy and chemoresistance of melphalan-resistant myeloma by directly inhibiting miR-140-5p, which elevated ATG14 level. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
