Molecule Information
General Information of the Molecule (ID: Mol01600)
Name |
hsa-miR-140-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 140
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
CAGUGGUUUUACCCUAUGGUAG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [1] | |||
Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell autophagy | Activation | hsa04140 | |
In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
hFOB1.19 cells | Fetal bone | Homo sapiens (Human) | CVCL_3708 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
IC50 assay; Flow cytometric analysis | |||
Mechanism Description | miR140-5p/HMGN5/autophagy regulatory loop plays a critical role in chemoresistance in osteosarcoma, miR 140-5p regulates osteosarcoma chemoresistance by targeting HMGN5 and autophagy. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Multiple myeloma | [2] | |||
Resistant Disease | Multiple myeloma [ICD-11: 2A83.0] | |||
Resistant Drug | Melphalan | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell autophagy | Activation | hsa04140 | ||
Cell viability | Activation | hsa05200 | ||
In Vitro Model | KMS11 cells | Peripheral blood | Homo sapiens (Human) | CVCL_2989 |
LP1 cells | Bone marrow | Homo sapiens (Human) | CVCL_0012 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | Linc00515 enhanced autophagy and chemoresistance of melphalan-resistant myeloma by directly inhibiting miR-140-5p, which elevated ATG14 level. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Multiple myeloma | [2] | |||
Sensitive Disease | Multiple myeloma [ICD-11: 2A83.0] | |||
Sensitive Drug | Melphalan | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell autophagy | Activation | hsa04140 | ||
Cell viability | Activation | hsa05200 | ||
In Vitro Model | KMS11 cells | Peripheral blood | Homo sapiens (Human) | CVCL_2989 |
LP1 cells | Bone marrow | Homo sapiens (Human) | CVCL_0012 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | Linc00515 enhanced autophagy and chemoresistance of melphalan-resistant myeloma by directly inhibiting miR-140-5p, which elevated ATG14 level. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.