Molecule Information

General Information of the Molecule (ID: Mol01600)

Name	hsa-miR-140-5p ,Homo sapiens
Synonyms	microRNA 140 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	CAGUGGUUUUACCCUAUGGUAG Click to Show/Hide
Ensembl ID	ENSG00000208017
HGNC ID	HGNC:31527
Mature Accession	MIMAT0000431
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Osteosarcoma				[1]
Resistant Disease	Osteosarcoma [ICD-11: 2B51.0]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell autophagy		Activation	hsa04140
In Vitro Model	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
	U2OS cells	Bone	Homo sapiens (Human)	CVCL_0042
	hFOB1.19 cells	Fetal bone	Homo sapiens (Human)	CVCL_3708
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	IC50 assay; Flow cytometric analysis
Mechanism Description	miR140-5p/HMGN5/autophagy regulatory loop plays a critical role in chemoresistance in osteosarcoma, miR 140-5p regulates osteosarcoma chemoresistance by targeting HMGN5 and autophagy.

Melphalan

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Multiple myeloma				[2]
Resistant Disease	Multiple myeloma [ICD-11: 2A83.0]			Disease Info
Resistant Drug	Melphalan			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell autophagy		Activation	hsa04140
	Cell viability		Activation	hsa05200
In Vitro Model	KMS11 cells	Peripheral blood	Homo sapiens (Human)	CVCL_2989
	LP1 cells	Bone marrow	Homo sapiens (Human)	CVCL_0012
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay; Flow cytometry assay
Mechanism Description	Linc00515 enhanced autophagy and chemoresistance of melphalan-resistant myeloma by directly inhibiting miR-140-5p, which elevated ATG14 level.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Multiple myeloma				[2]
Sensitive Disease	Multiple myeloma [ICD-11: 2A83.0]			Disease Info
Sensitive Drug	Melphalan			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell autophagy		Activation	hsa04140
	Cell viability		Activation	hsa05200
In Vitro Model	KMS11 cells	Peripheral blood	Homo sapiens (Human)	CVCL_2989
	LP1 cells	Bone marrow	Homo sapiens (Human)	CVCL_0012
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	MTT assay; Flow cytometry assay
Mechanism Description	Linc00515 enhanced autophagy and chemoresistance of melphalan-resistant myeloma by directly inhibiting miR-140-5p, which elevated ATG14 level.

References

Ref 1	MicroRNA-140-5p regulates osteosarcoma chemoresistance by targeting HMGN5 and autophagy. Sci Rep. 2017 Mar 24;7(1):416. doi: 10.1038/s41598-017-00405-3.
Ref 2	Knockdown of Linc00515 Inhibits Multiple Myeloma Autophagy and Chemoresistance by Upregulating miR-140-5p and Downregulating ATG14. Cell Physiol Biochem. 2018;48(6):2517-2527. doi: 10.1159/000492690. Epub 2018 Aug 17.