Molecule Information

General Information of the Molecule (ID: Mol01599)

• Name: hsa-miR-138-5p ,Homo sapiens
• Synonyms: microRNA 138-2
• Molecule Type: Mature miRNA
• Sequence: AGCUGGUGUUGUGAAUCAGGCCG
• Ensembl ID: ENSG00000207649
• HGNC ID: HGNC:31525
• Mature Accession: MIMAT0000430

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Low miR-138-5p levels and high ERCC1 and ERCC4 levels were associated with cisplatin resistance in gastric cancer cells.

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [2]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: There is an inverse correlation between the expression of miR-138-5p and GPR124 in lung adenocarcinoma specimens. Down-regulation of miR-138-5p contributes to gefitinib resistance and that restoration of miR-138-5p or inhibition GPR124 might serve as potential therapeutic approach for overcoming NSCLC gefitinib resistance.

References

• Ref 1: miR 138 5p modulates the expression of excision repair cross complementing proteins ERCC1 and ERCC4, and regulates the sensitivity of gastric cancer cells to cisplatin. Oncol Rep. 2019 Feb;41(2):1131-1139. doi: 10.3892/or.2018.6907. Epub 2018 Dec 6.
• Ref 2: miR-138-5p reverses gefitinib resistance in non-small cell lung cancer cells via negatively regulating G protein-coupled receptor 124. Biochem Biophys Res Commun. 2014 Mar 28;446(1):179-86. doi: 10.1016/j.bbrc.2014.02.073. Epub 2014 Feb 28.