Molecule Information
General Information of the Molecule (ID: Mol01598)
| Name |
hsa-miR-135a-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 135a-1
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UAUGGCUUUUUAUUCCUAUGUGA
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| miR135a-5p/AP2alpha /BCL2 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | AP-2alpha contains a putative miRNA-135a-5p target, which was confirmed as a direct target using the 3'-UTR luciferase reporter system. Additionally, an increase and decrease of miRNA-135a-5p inhi bited or impaired adriamycin-induced apoptosis in BGC-823 cells (p<0.05, compared with the group without gene intervention), respectively. Luciferase reporter experiments confirmed that AP-2alpha bound to the BCL-2 promoter and affected its transcription. Therefore, miRNA-135a-5p increased BCL-2 via AP-2alpha and consequently (+) cell resistance to apoptosis. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
