Molecule Information

General Information of the Molecule (ID: Mol01598)

• Name: hsa-miR-135a-5p ,Homo sapiens
• Synonyms: microRNA 135a-1
• Molecule Type: Mature miRNA
• Sequence: UAUGGCUUUUUAUUCCUAUGUGA
• Ensembl ID: ENSG00000207926
• HGNC ID: HGNC:31520
• Mature Accession: MIMAT0000428

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: miR135a-5p/AP2alpha /BCL2 signaling pathway; Regulation; hsa05206
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: AP-2alpha contains a putative miRNA-135a-5p target, which was confirmed as a direct target using the 3'-UTR luciferase reporter system. Additionally, an increase and decrease of miRNA-135a-5p inhi bited or impaired adriamycin-induced apoptosis in BGC-823 cells (p<0.05, compared with the group without gene intervention), respectively. Luciferase reporter experiments confirmed that AP-2alpha bound to the BCL-2 promoter and affected its transcription. Therefore, miRNA-135a-5p increased BCL-2 via AP-2alpha and consequently (+) cell resistance to apoptosis.

References

• Ref 1: Regulation of BGC-823 cell sensitivity to adriamycin via miRNA-135a-5p. Oncol Rep. 2014 Dec;32(6):2549-56. doi: 10.3892/or.2014.3546. Epub 2014 Oct 14.