Molecule Information
General Information of the Molecule (ID: Mol01594)
| Name |
hsa-miR-27b-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 27b
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UUCACAGUGGCUAAGUUCUGC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.0] | [1] | |||
| Resistant Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.0] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | OE19 cells | Esophagus | Homo sapiens (Human) | CVCL_1622 |
| kYSE410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Mechanism Description | Chemotherapy resistant sublines were found to have specific miRNA signatures, and these miRNA signatures were different for the cisplatin vs 5-FU resistant cells from the same tumor cell line, and also for EAC vs ESCC cells with resistance to the same specific chemotherapy agent. Amongst others, miR-27b-3p, miR-193b-3p, miR-192-5p, miR-378 a-3p, miR-125a-5p and miR-18a-3p were dysregulated, consistent with negative posttranscriptional control of KRAS, TYMS, ABCC3, CBL-B and ERBB2 expression via these miRNAs. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Anaplastic thyroid carcinoma [ICD-11: 2D10.3] | [2] | |||
| Sensitive Disease | Anaplastic thyroid carcinoma [ICD-11: 2D10.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| Cell viability | Inhibition | hsa05200 | ||
| miR27b-3p/PPARgamma signaling pathway | Regulation | N.A. | ||
| In Vitro Model | 8305C cells | Thyroid | Homo sapiens (Human) | CVCL_1053 |
| SW1736 cells | Thyroid | Homo sapiens (Human) | CVCL_3883 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | The inhibitor of miR-27b-3p can increase the Dox sensitivity of ATC Dox-resistant cells while over-expression of PPARGamma also increased the Dox sensitivity of ATC-resistant cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [3] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| MAPK/ERK signaling pathway | Inhibition | hsa04010 | ||
| PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | BCap37 cells | Breast | Homo sapiens (Human) | CVCL_0164 |
| Bads-200 cells | Breast | Homo sapiens (Human) | N.A. | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | miR-27b inhibits proliferation and resistance to PTX of breast cancer cell by repressing CBLB and GRB2 and suppresses activities of PI3k/AkT and MAPk/ERk signaling pathways through downregulation of CBLB and GRB2. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [4] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Tamoxifen | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 | |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
| BT549 cells | Breast | Homo sapiens (Human) | CVCL_1092 | |
| MCF10A cells | Breast | Homo sapiens (Human) | CVCL_0598 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Annexin V-FITC (fluorescein isothiocyanate)/PI analysis | |||
| Mechanism Description | Down-regulation of microRNA-27b-3p enhances tamoxifen resistance in breast cancer by increasing NR5A2 and CREB1 expression. Overexpression of NR5A2 and CREB1 reverses reduction of cell viability and induction of apoptosis by miR27b-3p mimics, and depletion of NR5A2 and CREB1 reverses induction of cell viability and reduction of apoptosis by miR509-5p inhibitors in tamoxifen-treated cells. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
