General Information of the Molecule (ID: Mol01594)
Name
hsa-miR-27b-3p ,Homo sapiens
Synonyms
microRNA 27b
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UUCACAGUGGCUAAGUUCUGC
    Click to Show/Hide
Ensembl ID
ENSG00000207864
HGNC ID
HGNC:31614
Mature Accession
MIMAT0000419
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.0] [1]
Resistant Disease Esophageal squamous cell carcinoma [ICD-11: 2B70.0]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model OE19 cells Esophagus Homo sapiens (Human) CVCL_1622
kYSE410 cells Esophagus Homo sapiens (Human) CVCL_1352
Experiment for
Molecule Alteration
qPCR
Mechanism Description Chemotherapy resistant sublines were found to have specific miRNA signatures, and these miRNA signatures were different for the cisplatin vs 5-FU resistant cells from the same tumor cell line, and also for EAC vs ESCC cells with resistance to the same specific chemotherapy agent. Amongst others, miR-27b-3p, miR-193b-3p, miR-192-5p, miR-378 a-3p, miR-125a-5p and miR-18a-3p were dysregulated, consistent with negative posttranscriptional control of KRAS, TYMS, ABCC3, CBL-B and ERBB2 expression via these miRNAs.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Anaplastic thyroid carcinoma [ICD-11: 2D10.3] [2]
Sensitive Disease Anaplastic thyroid carcinoma [ICD-11: 2D10.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
Cell viability Inhibition hsa05200
miR27b-3p/PPARgamma signaling pathway Regulation N.A.
In Vitro Model 8305C cells Thyroid Homo sapiens (Human) CVCL_1053
SW1736 cells Thyroid Homo sapiens (Human) CVCL_3883
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description The inhibitor of miR-27b-3p can increase the Dox sensitivity of ATC Dox-resistant cells while over-expression of PPARGamma also increased the Dox sensitivity of ATC-resistant cells.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [3]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
MAPK/ERK signaling pathway Inhibition hsa04010
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model BCap37 cells Breast Homo sapiens (Human) CVCL_0164
Bads-200 cells Breast Homo sapiens (Human) N.A.
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR-27b inhibits proliferation and resistance to PTX of breast cancer cell by repressing CBLB and GRB2 and suppresses activities of PI3k/AkT and MAPk/ERk signaling pathways through downregulation of CBLB and GRB2.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [4]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
T47D cells Breast Homo sapiens (Human) CVCL_0553
BT549 cells Breast Homo sapiens (Human) CVCL_1092
MCF10A cells Breast Homo sapiens (Human) CVCL_0598
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Annexin V-FITC (fluorescein isothiocyanate)/PI analysis
Mechanism Description Down-regulation of microRNA-27b-3p enhances tamoxifen resistance in breast cancer by increasing NR5A2 and CREB1 expression. Overexpression of NR5A2 and CREB1 reverses reduction of cell viability and induction of apoptosis by miR27b-3p mimics, and depletion of NR5A2 and CREB1 reverses induction of cell viability and reduction of apoptosis by miR509-5p inhibitors in tamoxifen-treated cells.
References
Ref 1 The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
Ref 2 miR-27b-3p is Involved in Doxorubicin Resistance of Human Anaplastic Thyroid Cancer Cells via Targeting Peroxisome Proliferator-Activated Receptor Gamma. Basic Clin Pharmacol Toxicol. 2018 Dec;123(6):670-677. doi: 10.1111/bcpt.13076. Epub 2018 Aug 5.
Ref 3 miR-27b-3p inhibits proliferation and potentially reverses multi-chemoresistance by targeting CBLB/GRB2 in breast cancer cells. Cell Death Dis. 2018 Feb 7;9(2):188. doi: 10.1038/s41419-017-0211-4.
Ref 4 Downregulation of microRNA-27b-3p enhances tamoxifen resistance in breast cancer by increasing NR5A2 and CREB1 expression. Cell Death Dis. 2016 Nov 3;7(11):e2454. doi: 10.1038/cddis.2016.361.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.